RAB18 (NM_001256410) Human Untagged Clone

CAT#: SC330419

RAB18 (untagged) - Homo sapiens RAB18, member RAS oncogene family (RAB18), transcript variant 2



  "NM_001256410" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-RAB18 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RAB18LI1; WARBM3
Vector pCMV6-Entry
Sequence Data
>SC330419 representing NM_001256410.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACGAGGACGTGCTAACCACCCTGAAGATCCTCATCATCGGCGAGAGTGGGGTGGGCAAGTCCAGC
CTGCTCTTGAGGTTCACAGATGATACGTTTGATCCAGAACTTGCAGCAACAATAGGTGTTGACTTTAAG
GTGAAAACAATTTCAGTGGATGGAAATAAGGCTAAACTTGCAATATGGGTTACTTTGCATCAGCAGACT
GCAAACTTTTTCTTAAAGAGCCAGATAGGAAATAGTCCAATCCTGAAGTGGGCCATGTGGCAATACGAT
ACTGCTGGTCAAGAGAGGTTTAGAACATTAACTCCCAGCTATTATAGAGGTGCACAGGGTGTTATATTA
GTTTATGATGTCACAAGAAGAGATACATTTGTTAAACTGGATAATTGGTTAAATGAATTGGAAACATAC
TGTACAAGAAATGACATAGTAAACATGCTAGTTGGAAATAAAATCGATAAGGAAAATCGTGAAGTCGAT
AGAAATGAAGGCCTGAAATTTGCACGAAAGCATTCCATGTTATTTATAGAGGCAAGTGCAAAAACCTGT
GATGGTGTACAATGTGCCTTTGAAGAACTTGTTGAAAAGATCATTCAGACCCCTGGACTGTGGGAAAGT
GAGAACCAGAATAAAGGAGTCAAACTGTCACACAGGGAAGAAGGCCAAGGAGGAGGAGCCTGTGGTGGT
TATTGCTCTGTGTTATAA

Restriction Sites SgfI-MluI     
ACCN NM_001256410
Insert Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256410.1
RefSeq Size 5090 bp
RefSeq ORF 708 bp
Locus ID 22931
UniProt ID Q9NP72
Protein Families Druggable Genome
MW 26.4 kDa
Gene Summary The protein encoded by this gene is a member of a family of Ras-related small GTPases that regulate membrane trafficking in organelles and transport vesicles. Knockdown studies is zebrafish suggest that this protein may have a role in eye and brain development. Mutations in this gene are associated with Warburg micro syndrome type 3. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (2) contains an additional in-frame coding exon compared to variant 1. This results in a longer isoform (2) with a 29 aa protein segment not found in isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...