LRRC39 (NM_001256387) Human Untagged Clone

CAT#: SC330409

LRRC39 (untagged) - Homo sapiens leucine rich repeat containing 39 (LRRC39), transcript variant 4



  "NM_001256387" in other vectors (2)

CNY 3,230.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
LRRC39 mouse monoclonal antibody, clone OTI2D9 (formerly 2D9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC330409 representing NM_001256387.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACAGAAAATGTGGTTTGTACTGGGGCTGTCAATGCTGTAAAGGAAGTTTGGGAAAAAAGAATAAAG
AAACTCAATGAAGACCTGAAGCGAGAGAAGGAATTTCAACACAAGCTAGTGCGGATCTGGGAAGAACGA
GTAAGCTTAACCAAGCTAAGAGAAAAGGTCACCAGGGAAGATGGAAGAGTCATTTTGAAGATAGAAAAA
GAGGAATGGAAGACCCTCCCTTCTTCTCTGCTGAAACTGAATCAACTACAGGAATGGCAACTTCATAGA
ACTGGTTTGCTGAAAATTCCTGAATTCATTGGAAGATTCCAGAACCTCATTGTGTTAGATTTATCTCGA
AACACAATTTCAGAGATACCACCAGGGATTGGACTGCTTACTAGACTTCAGGAACTGATTCTCAGCTAC
AACAAAATCAAGACTGTCCCCAAGGAACTAAGTAATTGTGCCAGCTTGGAGAAACTAGAACTGGCTGTT
AACAGAGATATATGTGATCTTCCACAAGAGCTCAGCAATCTGCTAAAACTTACTCACCTTGATCTGAGT
ATGAACGATTTTACTACAATCCCTCTTGCTGTGTTGAACATGCCTGCCCTTGAGTGGCTGGACATGGGA
AGCAACAAACTTGAACAACTTCCTGATACTATAGAAAGAATGCAAAATCTACATACGTTATGGCTGCAA
CGAAATGAAATAACATGCTTGCCTCAAACAATCAGCAATATGAAAAATCTGGGTACTCTTGTTCTCAGC
AACAATAAACTGCAAGATATTCCAGTATGCATGGAAGAAATGGCAAATCTGAGGTTTGTCAACTTCAGA
GACAACCCACTGAAATTGAAAGTATCACTTCCTCCCAGTGAAGGCACAGATGAAGAAGAGGAACGGGAA
TTATTTGGCCTTCAGTTTATGCACACATACATACAAGAGTCACGGAGAAGAGCAGATCACCAAGTCAAC
GGTTCAACTACTTTACCAATCTCCATAAATACGGATGGATAA

Restriction Sites SgfI-MluI     
ACCN NM_001256387
Insert Size 1008 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256387.1
RefSeq Size 1825 bp
RefSeq ORF 1008 bp
Locus ID 127495
UniProt ID Q96DD0
Protein Families Druggable Genome
MW 38.8 kDa
Gene Summary Component of the sarcomeric M-band which plays a role in myocyte response to biomechanical stress. May regulate expression of other M-band proteins via an SRF-dependent pathway. Important for normal contractile function in heart.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) has multiple differences, compared to variant 1. The resulting protein (isoform 2) has a distinct and shorter C-terminus compared to isoform 1. Variants 2, 3, and 4 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...