Prostaglandin dehydrogenase 1 (HPGD) (NM_001256305) Human Untagged Clone

CAT#: SC330392

HPGD (untagged) - Homo sapiens hydroxyprostaglandin dehydrogenase 15-(NAD) (HPGD), transcript variant 4



  "NM_001256305" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
HPGD (Prostaglandin dehydrogenase 1) mouse monoclonal antibody, clone OTI2C10 (formerly 2C10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 15-PGDH; PGDH; PGDH1; PHOAR1; SDR36C1
Vector pCMV6-Entry
Sequence Data
>SC330392 representing NM_001256305.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCACGTGAACGGCAAAGTGGCGCTGGTGACCGGCGCGGCTCAGGGCATAGGCAGAGCCTTTGCAGAG
GCGCTGCTGCTTAAGGGCGCCAAGGTAGCGCTGGTGGATTGGAATCTTGAAGCAGGTGTACAGTGTAAA
GCTGCCCTGGATGAGCAGTTTGAACCTCAGAAGACTCTGTTCATCCAGTGCGATGTGGCTGACCAGCAA
CAACTGAGAGACACTTTTAGAAAAGTTGTAGACCACTTTGGAAGACTGGACATTTTGGTCAATAATGCT
GGAGTGAATAATGAGAAAAACTGGGAAAAAACTCTGCAAATTAATTTGGTTTCTGTTATCAGTGGAACC
TATCTTGGTTTGGATTACATGAGTAAGCAAAATGGAGGTGAAGGCGGCATCATTATCAATATGTCATCT
TTAGCAGCCCACCATTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256305
Insert Size 432 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256305.1
RefSeq Size 2803 bp
RefSeq ORF 432 bp
Locus ID 3248
UniProt ID P15428
Protein Families Druggable Genome
MW 15.5 kDa
Gene Summary This gene encodes a member of the short-chain nonmetalloenzyme alcohol dehydrogenase protein family. The encoded enzyme is responsible for the metabolism of prostaglandins, which function in a variety of physiologic and cellular processes such as inflammation. Mutations in this gene result in primary autosomal recessive hypertrophic osteoarthropathy and cranioosteoarthropathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Transcript Variant: This variant (4) lacks two alternate exons in the 3' coding region, which results in a frameshift and early stop codon, compared to variant 1. It encodes isoform 4, which is shorter and contains a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Prostaglandin dehydrogenase 1产品

Customer Reviews 
Loading...