CLIC5 (NM_001256023) Human Untagged Clone

CAT#: SC330350

CLIC5 (untagged) - Homo sapiens chloride intracellular channel 5 (CLIC5), transcript variant 3



  "NM_001256023" in other vectors (2)

CN¥ 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00


CLIC5 rabbit polyclonal antibody
    • 25 ul

CN¥ 800.00
CN¥ 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DFNB102; DFNB103; MST130; MSTP130
Vector pCMV6-Entry
Sequence Data
>SC330350 representing NM_001256023.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACAGACTCGGCGACAGCTAACGGGGACGACAGGGACCCCGAGATCGAGCTCTTTGTGAAGGCTGGA
ATCGATGGAGAAAGCATCGGCAACTGTCCTTTCTCTCAGCGCCTCTTCATGATCCTCTGGCTGAAAGGA
GTCGTGTTCAATGTCACCACTGTGGATCTGAAAAGAAAGCCAGCTGACCTGCACAACCTAGCCCCCGGC
ACGCACCCGCCCTTCCTGACCTTCAACGGGGACGTGAAGACAGACGTCAATAAGATCGAGGAGTTCCTG
GAGGAGACCTTGACCCCTGAAAAGTACCCCAAACTGGCTGCAAAACACCGGGAATCCAACACAGCGGGC
ATCGACATCTTTTCCAAGTTTTCTGCCTACATCAAAAATACCAAGCAGCAGAACAATGCTGCTCTTGAA
AGAGGCCTAACCAAGGCTCTAAAGAAATTGGATGACTACCTGAACACCCCTCTACCAGAGGAGATTGAC
GCCAACACTTGTGGGGAAGACAAGGGGTCCCGGCGCAAGTTCCTGGATGGGGATGAGCTGACCCTGGCT
GACTGCAATCTGTTGCCCAAGCTCCATGTGGTCAAGGAACAAGTACCACTGAAAGGGATGATATAA

Restriction Sites SgfI-MluI     
ACCN NM_001256023
Insert Size 618 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256023.1
RefSeq Size 2067 bp
RefSeq ORF 618 bp
Locus ID 53405
UniProt ID Q9NZA1
Protein Families Druggable Genome, Ion Channels: Other
MW 22.8 kDa
Gene Summary This gene encodes a member of the chloride intracellular channel (CLIC) family of chloride ion channels. The encoded protein associates with actin-based cytoskeletal structures and may play a role in multiple processes including hair cell stereocilia formation, myoblast proliferation and glomerular podocyte and endothelial cell maintenance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (3) differs in the 5' and 3' UTRs and initiates translation at an alternate start codon, compared to variant 1. the encoded isoform (c) is shorter and has distinct N- and C-termini, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...