GMDS (NM_001253846) Human Untagged Clone

CAT#: SC330312

GMDS (untagged) - Homo sapiens GDP-mannose 4,6-dehydratase (GMDS), transcript variant 2



  "NM_001253846" in other vectors (2)

CNY 3,330.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
GMDS mouse monoclonal antibody, clone OTI2A1 (formerly 2A1)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GMD; SDR3E1
Vector pCMV6-Entry
Sequence Data
>SC330312 representing NM_001253846.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTGTAAAATGGATGGTTCCTACCTGGCTGAGTTCCTGCTGGAGAAAGGCTATGAGGTCCATGGAATT
GTACGGCGGTCCAGTTCATTTAATACGGGTCGAATTGAGCATCTGTATAAGAATCCCCAGGCTCACATT
GAAGGAAACATGAAGTTGCACTATGGCGATCTCACTGACAGTACCTGCCTTGTGAAGATCATTAATGAA
GTAAAGCCCACAGAGATCTACAACCTTGGAGCCCAGAGCCACGTCAAAATTTCCTTTGACCTCGCTGAG
TACACTGCGGACGTTGACGGAGTTGGCACTCTACGACTTCTAGATGCAGTTAAGACTTGTGGCCTTATC
AACTCTGTGAAGTTCTACCAAGCCTCAACAAGTGAACTTTATGGGAAAGTGCAGGAAATACCCCAGAAG
GAGACCACCCCTTTCTATCCCCGGTCACCCTATGGGGCAGCAAAACTCTATGCCTATTGGATTGTGGTG
AACTTCCGTGAGGCGTATAATCTCTTTGCAGTGAACGGCATTCTCTTCAATCATGAGAGTCCCAGAAGA
GGAGCTAATTTCGTTACTCGAAAAATTAGCCGGTCAGTAGCTAAGATTTACCTTGGACAACTGGAATGT
TTCAGTTTGGGAAATCTGGATGCCAAACGAGATTGGGGCCATGCCAAGGACTATGTGGAGGCTATGTGG
TTGATGTTGCAGAATGATGAGCCGGAGGACTTCGTTATAGCTACTGGGGAGGTCCATAGTGTCCGGGAA
TTTGTCGAGAAATCATTCTTGCACATTGGAAAAACCATTGTGTGGGAAGGAAAGAATGAAAATGAAGTG
GGCAGATGTAAAGAGACCGGCAAAGTTCACGTGACTGTGGATCTCAAGTACTACCGGCCAACTGAAGTG
GACTTTCTGCAGGGCGACTGCACCAAAGCGAAACAGAAGCTGAACTGGAAGCCCCGGGTCGCTTTCGAT
GAGCTGGTGAGGGAGATGGTGCACGCCGACGTGGAGCTCATGAGGACAAACCCCAATGCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001253846
Insert Size 1029 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001253846.1
RefSeq Size 1446 bp
RefSeq ORF 1029 bp
Locus ID 2762
UniProt ID O60547
Protein Families Druggable Genome
Protein Pathways Amino sugar and nucleotide sugar metabolism, Fructose and mannose metabolism, Metabolic pathways
MW 39.1 kDa
Gene Summary GDP-mannose 4,6-dehydratase (GMD; EC 4.2.1.47) catalyzes the conversion of GDP-mannose to GDP-4-keto-6-deoxymannose, the first step in the synthesis of GDP-fucose from GDP-mannose, using NADP+ as a cofactor. The second and third steps of the pathway are catalyzed by a single enzyme, GDP-keto-6-deoxymannose 3,5-epimerase, 4-reductase, designated FX in humans (MIM 137020).[supplied by OMIM, Aug 2009]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...