RPL15 (NM_001253384) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	DBA12; EC45; L15; RPL10; RPLY10; RPYL10
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330299 representing NM_001253384. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGGTGCATACAAGTACATCCAGGAGCTATGGAGAAAGAAGCAGTCTGATGTCATGCGCTTTCTTCTG AGGGTCCGCTGCTGGCAGTACCGCCAGCTCTCTGCTCTCCACAGGGCTCCCCGCCCCACCCGGCCTGAT AAAGCGCGCCGACTGGGCTACAAGGCCAAGCAAGGTTACGTTATATATAGGATTCGTGTTCGCCGTGGT GGCCGAAAACGCCCAGTTCCTAAGGGTGCAACTTACGGCAAGCCTGTCCATCATGGTGTTAACCAGCTA AAGTTTGCTCGAAGCCTTCAGTCCGTTGCAGAGGAGCGAGCTGGACGCCACTGTGGGGCTCTGAGAGTC CTGAATTCTTACTGGATGGAGTCTCACTCTCACTCAGGTGGGAGTGCAGTGGGGCAATCACGGCTCACT GCAACCTCTGTCTCCCGGGTTTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001253384
Insert Size	438 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001253384.1
RefSeq Size	2860 bp
RefSeq ORF	438 bp
Locus ID	6138
UniProt ID	P61313
Protein Pathways	Ribosome
MW	16.7 kDa
Gene Summary	Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L15E family of ribosomal proteins and a component of the 60S subunit. This gene shares sequence similarity with the yeast ribosomal protein YL10 gene. Elevated expression of this gene has been observed in esophageal tumors and gastric cancer tissues, and deletion of this gene has been observed in a Diamond-Blackfan anemia (DBA) patient. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Mar 2017] Transcript Variant: This variant (6) includes an alternate exon in the 3' UTR and coding region, which results in a frameshift, compared to variant 1. The resulting protein (isoform 2) has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.