CED6 (GULP1) (NM_001252669) Human Untagged Clone

CAT#: SC330293

GULP1 (untagged) - Homo sapiens GULP, engulfment adaptor PTB domain containing 1 (GULP1), transcript variant 3



  "NM_001252669" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
GULP1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CED-6; CED6; GULP
Vector pCMV6-Entry
Sequence Data
>SC330293 representing NM_001252669.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAACCGTGCTTTTAGCAGGAAGAAAGACAAAACATGGATGCATACACCTGAAGCTTTATCAAAACAT
TTCATTCCCTATAATGCAAAGGCTGAAGAGATCACTTTAACAATTGGCCAAGCATTTGACCTGGCATAC
AGGAAATTTCTAGAATCAGGAGGAAAAGATGTTGAAACAAGAAAACAGATCGCAGGGTTACAAAAAAGA
ATCCAAGACTTAGAAACAGAAAATATGGAACTTAAAAATAAAGTACAAGATTTGGAAAACCAACTGAGA
ATAACTCAAGTATCAGCACCTCCAGCAGGCAGTATGACACCTAAGTCGCCCTCCACTGACATCTTTGAT
ATGATTCCATTTTCTCCAATATCACACCAGTCTTCGATGCCTACTCGCAATGGCACACAGCCACCTCCA
GTACCTAGTAGATCTACTGAGATTAAACGGGACCTGTTTGGAGCAGAACCTTTTGACCCATTTAACTGT
GGAGCAGCAGATTTCCCTCCAGATATTCAATCAAAATTAGATGAGATGCAGGAGGGGTTCAAAATGGGA
CTAACTCTTGAAGGCACAGTATTTTGTCTCGACCCGTTAGACAGTAGGTGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001252669
Insert Size 606 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001252669.1
RefSeq Size 3203 bp
RefSeq ORF 606 bp
Locus ID 51454
UniProt ID Q9UBP9
Protein Families Druggable Genome
MW 22.6 kDa
Gene Summary The protein encoded by this gene is an adapter protein necessary for the engulfment of apoptotic cells by phagocytes. Several transcript variants, some protein coding and some thought not to be protein coding, have been found for this gene. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (3) lacks an alternate in-frame coding segment compared to variant 1. The resulting isoform (c) has the same N- and C-termini but is shorter compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...