TRPM1 (NM_001252030) Human Untagged Clone

CAT#: SC330264

TRPM1 (untagged) - Homo sapiens transient receptor potential cation channel, subfamily M, member 1 (TRPM1), transcript variant 4



  "NM_001252030" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-TRPM1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CSNB1C; LTRPC1; MLSN1
Vector pCMV6-Entry
Sequence Data
>SC330264 representing NM_001252030.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAAGACTCTAACAGGTGTTGCTGTGGCCAGTTCACCAACCAGCATATCCCCCCTCTGCCAAGTGCA
ACACCCAGCAAAAATGAAGAGGAAAGCAAACAGGTGGAGACTCAGCCTGAGAAATGGTCTGTTGCCAAG
CACACCCAGAGCTACCCAACAGATTCCTATGGAGTTCTTGAATTCCAGGGTGGCGGATATTCCAATAAA
GCCATGGTGAGAAAGGCATTCAGACATGGTGCCACTAGGATCACAGCTTTCATTGGCGGCCAGTCTCCC
AGCCCCAAACTGCAGATACCTGGTCTTCTTCATGGCTGTGGCTCAATCTTCCTAGATATTTCATTGAAA
AACCAAGAGATATATCTGTGCACATGGCTTTTAGCCATGAGGCTTGGAAACTGGACACCACTGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001252030
Insert Size 411 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001252030.1
RefSeq Size 1002 bp
RefSeq ORF 411 bp
Locus ID 4308
UniProt ID Q7Z4N2
Protein Families Druggable Genome, Ion Channels: Transient receptor potential, Transmembrane
MW 15.1 kDa
Gene Summary This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (4) differs in the 5' UTR, 3' UTR, and coding region, compared to variant 1. The resulting isoform (4) is shorter at the N-terminus and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...