RAP1B (NM_001251918) Human Untagged Clone

CAT#: SC330247

RAP1B (untagged) - Homo sapiens RAP1B, member of RAS oncogene family (RAP1B), transcript variant 4



  "NM_001251918" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-RAP1B Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms K-REV; RAL1B
Vector pCMV6-Entry
Sequence Data
>SC330247 representing NM_001251918.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCGTGAGTATAAGCTAGTCGTTCTTGGCTCAGGAGGCGTTGGAAAGTCTGCTTTGGAGCAATTTACA
GCAATGAGGGATTTATACATGAAAAATGGACAAGGATTTGCATTAGTTTATTCCATCACAGCACAGTCC
ACATTTAACGATTTACAAGACCTGAGAGAACAGATTCTTCGAGTTAAAGACACTGATGATGTTCCAATG
ATTCTTGTTGGTAATAAGTGTGACTTGGAAGATGAAAGAGTTGTAGGGAAGGAACAAGGTCAAAATCTA
GCAAGACAATGGAACAACTGTGCATTCTTAGAATCTTCTGCAAAATCAAAAATAAATGTTAATGAGATC
TTTTATGACCTAGTGCGGCAAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCTCGCAAAAAGTCATCA
TGTCAGCTGCTTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001251918
Insert Size 429 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001251918.1
RefSeq Size 2037 bp
RefSeq ORF 429 bp
Locus ID 5908
UniProt ID P61224
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway, Focal adhesion, Leukocyte transendothelial migration, Long-term potentiation, MAPK signaling pathway, Neurotrophin signaling pathway, Renal cell carcinoma
MW 16 kDa
Gene Summary This gene encodes a member of the RAS-like small GTP-binding protein superfamily. Members of this family regulate multiple cellular processes including cell adhesion and growth and differentiation. This protein localizes to cellular membranes and has been shown to regulate integrin-mediated cell signaling. This protein also plays a role in regulating outside-in signaling in platelets. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 5, 6 and 9. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (4) differs in the 5' UTR and lacks two in-frame exons in the coding region, compared to variant 1. The resulting isoform (2) is shorter, compared to isoform 1. Variants 3 and 4 encode the same isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...