DLST (NM_001244883) Human Untagged Clone

CAT#: SC330226

DLST (untagged) - Homo sapiens dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) (DLST), transcript variant 2



  "NM_001244883" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal antibody to DLST (dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex))
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DLTS; KGD2; PGL7
Vector pCMV6-Entry
Sequence Data
>SC330226 representing NM_001244883.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTGTCCCGATCCCGCTGTGTGTCTCGGGCGTTCAGCCGCTCGCTCTCCGCCTTCCAGAAGGGGAAC
TGCCCTCTAGGGAGACGTTCCCTGCCTGGGGTCTCCTTATGCCAGGGACCAGGTTACCCTAACAGCAGG
AAGGTTGTCATTAACAACAGTGTCTTCAGTGTTCGCTTTTTCAGAACTACAGCTGTATGCAAGGATGAC
TTGGTTACAGTCAAAACCCCAGCGTTTGCAGAATCTGTCACAGAGGGAGATGTCAGGTGGGAGAAAGCT
GTTGGAGACACAGTTGCAGAAGATGAAGTGGTTTGTGAGATTGAAACTGACAAGACATCTGTGCAGGTT
CCATCACCAGCAAATGGCGTGATTGAAGCTCTTTTGGTACCTGATGGGGGAAAAGTCGAAGGAGGCACT
CCACTTTTCACACTCAGGAAAACTGGTGGTAAAGAAGTTCTCCTGGTGGTCAAGGTCTCCAGTGTTCCC
TCTTGGGATTGGGACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001244883
Insert Size 501 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001244883.1
RefSeq Size 1229 bp
RefSeq ORF 501 bp
Locus ID 1743
Protein Pathways Citrate cycle (TCA cycle), Lysine degradation, Metabolic pathways
MW 17.9 kDa
Gene Summary This gene encodes a mitochondrial protein that belongs to the 2-oxoacid dehydrogenase family. This protein is one of the three components (the E2 component) of the 2-oxoglutarate dehydrogenase complex that catalyzes the overall conversion of 2-oxoglutarate to succinyl-CoA and CO(2). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (2) differs at the 3' end compared to variant 1. This results in a shorter isoform (2) with a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...