SMUG1 (NM_001243791) Human Untagged Clone
CAT#: SC330190
SMUG1 (untagged) - Homo sapiens single-strand-selective monofunctional uracil-DNA glycosylase 1 (SMUG1), transcript variant 6
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FDG; HMUDG; UNG3 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330190 representing NM_001243791.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCCCCAGGCTTTCCTGCTGGGGTCCATCCATGAGCCTGCAGGTGCCCTCATGGAGCCCCAGCCCTGC CCTGGAAGCTTGGCTGAGAGCTTCCTGGAGGAGGAGCTTCGGCTCAATGCTGAGCTGAGCCAGCTGCAG TTTTCGGAGCCTGTGGGCATCATCTACAATCCCGTGGAGTATGCATGGGAGCCACATCGCAACTACGTG ACTCGCTACTGCCAGGGCCCCAAGGAAGTACTCTTCCTGGGCATGAACCCTGGACCTTTTGGCATGGCC CAGACTGGGGTGCCCTTTGGGGAAGTAAGCATGGTCCGGGACTGGTTGGGCATTGTGGGGCCTGTGCTG ACCCCTCCCCAAGAGCATCCTAAACGACCAGTGCTGGGACTGGAGTGCCCACAGTCAGAAGGACCAAGA CAAAGCATGGGACATGAAATTAAGAGTGAACTTCTTATGGGAGGCTGCAGCTGGATCAGAGGAAAAATC CAGTGTGACAGAGTGCAAGTCAGAAGACCTGGCTTTTCATCCCAGCTTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243791 |
Insert Size | 534 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001243791.1 |
RefSeq Size | 685 bp |
RefSeq ORF | 534 bp |
Locus ID | 23583 |
UniProt ID | Q53HV7 |
Protein Families | Druggable Genome |
Protein Pathways | Base excision repair |
MW | 19.6 kDa |
Gene Summary | This gene encodes a protein that participates in base excision repair by removing uracil from single- and double-stranded DNA. Many alternatively spliced transcript variants exist for this gene; the full-length nature is known for some but not all of the variants. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (6) differs in the 5' UTR, 3' UTR, and coding region, compared to variant 1. The resulting protein (isoform 2) has a shorter and different C-terminus when it is compared to isoform 1. Variants 4, 5, and 6 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231979 | SMUG1 (Myc-DDK tagged) - Homo sapiens single-strand-selective monofunctional uracil-DNA glycosylase 1 (SMUG1), transcript variant 6 |
CNY 3,990.00 |
|
RG231979 | SMUG1 (tGFP-tagged) - Homo sapiens single-strand-selective monofunctional uracil-DNA glycosylase 1 (SMUG1), transcript variant 6 |
CNY 4,370.00 |