PLTP (NM_001242921) Human Untagged Clone

CAT#: SC330067

PLTP (untagged) - Homo sapiens phospholipid transfer protein (PLTP), transcript variant 4



  "NM_001242921" in other vectors (2)

CN¥ 3,900.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PLTP Antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BPIFE; HDLCQ9
Vector pCMV6-Entry
Sequence Data
>SC330067 representing NM_001242921.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTTCAAATCACCAATGCCTCCTTGGGGCTGCGCTTCCGGAGACAGCTGCTCTACTGGTTCTTCTAT
GATGGGGGCTACATCAACGCCTCAGCTGAGGGTGTGTCCATCCGCACTGGTCTGGAGCTCTCCCGGGAT
CCCGCTGGACGGATGAAAGTGTCCAATGTCTCCTGCCAGGCCTCTGTCTCCAGAATGCACGCGGCCTTC
GGGGGAACCTTCAAGAAGGTGTATGATTTTCTCTCCACGTTCATCACCTCAGGGATGCGCTTCCTCCTC
AACCAGCAGATCTGCCCTGTCCTCTACCACGCAGGGACGGTCCTGCTCAACTCCCTCCTGGACACCGTG
CCTGTGCGCAGTTCTGTGGACGAGCTTGTTGGCATTGACTATTCCCTCATGAAGGATCCTGTGGCTTCC
ACCAGCAACCTGGACATGGACTTCCGGGGGGCCTTCTTCCCCCTGACTGAGAGGAACTGGAGCCTCCCC
AACCGGGCAGTGGAGCCCCAGCTGCAGGAGGAAGAGCGGATGGTGTATGTGGCCTTCTCTGAGTTCTTC
TTCGACTCTGCCATGGAGAGCTACTTCCGGGCGGGGGCCCTGCAGCTGTTGCTGGTGGGGGACAAGGTG
CCCCACGACCTGGACATGCTGCTGAGGGCCACCTACTTTGGGAGCATTGTCCTGCTGAGCCCAGCAGTG
ATTGACTCCCCATTGAAGCTGGAGCTGCGGGTCCTGGCCCCACCGCGCTGCACCATCAAGCCCTCTGGC
ACCACCATCTCTGTCACTGCTAGCGTCACCATTGCCCTGGTCCCACCAGACCAGCCTGAGGTCCAGCTG
TCCAGCATGACTATGGACGCCCGTCTCAGCGCCAAGATGGCTCTCCGGGGGAAGGCCCTGCGCACGCAG
CTGGACCTGCGCAGGTTCCGAATCTATTCCAACCATTCTGCACTGGAGTCGCTGGCTCTGATCCCATTA
CAGGCCCCTCTGAAGACCATGCTGCAGATTGGGGTGATGCCCATGCTCAATGAGCGGACCTGGCGTGGG
GTGCAGATCCCACTACCTGAGGGCATCAACTTTGTGCATGAGGTGGTGACGAACCATGCGGGATTCCTC
ACCATCGGGGCTGATCTCCACTTTGCCAAAGGGCTGCGAGAGGTGATTGAGAAGAACCGGCCTGCTGAT
GTCAGGGCGTCCACTGCCCCCACACCGTCCACAGCAGCTGTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242921
Insert Size 1218 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242921.1
RefSeq Size 1727 bp
RefSeq ORF 1218 bp
Locus ID 5360
UniProt ID P55058
Protein Families Druggable Genome, Secreted Protein
Protein Pathways PPAR signaling pathway
MW 44.8 kDa
Gene Summary The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon compared to variant 1. The resulting protein (isoform d) is shorter and has a distinct N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...