PRKACB (NM_001242858) Human Untagged Clone

CAT#: SC330031

PRKACB (untagged) - Homo sapiens protein kinase, cAMP-dependent, catalytic, beta (PRKACB), transcript variant 5



  "NM_001242858" in other vectors (2)

CNY 3,330.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


PRKACB rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAFD2; PKA C-beta; PKACB
Vector pCMV6-Entry
Sequence Data
>SC330031 representing NM_001242858.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGATTGTTGAAAGAGTTTCTAGCCAAAGCCAAAGAAGACTTTTTGAAAAAATGGGAGAATCCAACT
CAGAATAATGCCGGACTTGAAGATTTTGAAAGGAAAAAAACCCTTGGAACAGGTTCATTTGGAAGAGTC
ATGTTGGTAAAACACAAAGCCACTGAACAGTATTATGCCATGAAGATCTTAGATAAGCAGAAGGTTGTT
AAACTGAAGCAAATAGAGCATACTTTGAATGAGAAAAGAATATTACAGGCAGTGAATTTTCCTTTCCTT
GTTCGACTGGAGTATGCTTTTAAGGATAATTCTAATTTATACATGGTTATGGAATATGTCCCTGGGGGT
GAAATGTTTTCACATCTAAGAAGAATTGGAAGGTTCAGTGAGCCCCATGCACGGTTCTATGCAGCTCAG
ATAGTGCTAACATTCGAGTACCTCCATTCACTAGACCTCATCTACAGAGATCTAAAACCTGAAAATCTC
TTAATTGACCATCAAGGCTATATCCAGGTCACAGACTTTGGGTTTGCCAAAAGAGTTAAAGGCAGAACT
TGGACATTATGTGGAACTCCAGAGTATTTGGCTCCAGAAATAATTCTCAGCAAGGGCTACAATAAGGCA
GTGGATTGGTGGGCATTAGGAGTGCTAATCTATGAAATGGCAGCTGGCTATCCCCCATTCTTTGCAGAC
CAACCAATTCAGATTTATGAAAAGATTGTTTCTGGAAAGGTCCGATTCCCATCCCACTTCAGTTCAGAT
CTCAAGGACCTTCTACGGAACCTGCTGCAGGTGGATTTGACCAAGAGATTTGGAAATCTAAAGAATGGT
GTCAGTGATATAAAAACTCACAAGTGGTTTGCCACGACAGATTGGATTGCTATTTACCAGAGGAAGGTT
GAAGCTCCATTCATACCAAAGTTTAGAGGCTCTGGAGATACCAGCAACTTTGATGACTATGAAGAAGAA
GATATCCGTGTCTCTATAACAGAAAAATGTGCAAAAGAATTTGGTGAATTTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001242858
Insert Size 1020 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242858.1
RefSeq Size 4260 bp
RefSeq ORF 1020 bp
Locus ID 5567
UniProt ID P22694
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Apoptosis, Calcium signaling pathway, Chemokine signaling pathway, Dilated cardiomyopathy, Gap junction, GnRH signaling pathway, Hedgehog signaling pathway, Insulin signaling pathway, Long-term potentiation, MAPK signaling pathway, Melanogenesis, Olfactory transduction, Oocyte meiosis, Prion diseases, Progesterone-mediated oocyte maturation, Taste transduction, Vascular smooth muscle contraction, Vibrio cholerae infection, Wnt signaling pathway
MW 39.5 kDa
Gene Summary The protein encoded by this gene is a member of the serine/threonine protein kinase family. The encoded protein is a catalytic subunit of cAMP (cyclic AMP)-dependent protein kinase, which mediates signalling though cAMP. cAMP signaling is important to a number of processes, including cell proliferaton and differentiation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (5) differs in the 5' exon structure, compared to variant 1. The encoded isoform (5, also known as Cbeta3) has a distinct N-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...