CAMTA1 (NM_001242701) Human Untagged Clone

CAT#: SC330004

CAMTA1 (untagged) - Homo sapiens calmodulin binding transcription activator 1 (CAMTA1), transcript variant 3



  "NM_001242701" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CAMTA1 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CANPMR
Vector pCMV6-Entry
Sequence Data
>SC330004 representing NM_001242701.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTGGCGCGCGGAGGGGAAATGGCTGCCGAAAACAAGCCGGAAGAGCGTTTCCCAAAGTGTATTCTGC
GGAACTAGCACCTACTGTGTTCTCAACACCGTGCCACCTATAGAAGATGATCATGGGAACAGCAATAGT
AGTCATGTAAAAATCTTTTTACCGAAAAAGCTGCTTGAATGTCTGCCGAAATGTTCAAGTTTACCAAAA
GAGAGGCACCGCTGGAACACTAATGAGGCTCTCACCACACACTTGTTCATGGGCGCAGCAAAGAAGAGG
GATCCACAGAGCTGGAGCCATGAGGGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242701
Insert Size 306 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001242701.1
RefSeq Size 997 bp
RefSeq ORF 306 bp
Locus ID 23261
UniProt ID Q9Y6Y1
Protein Families Transcription Factors
MW 11.5 kDa
Gene Summary The protein encoded by this gene contains a CG1 DNA-binding domain, a transcription factor immunoglobulin domain, ankyrin repeats, and calmodulin-binding IQ motifs. The encoded protein is thought to be a transcription factor and may be a tumor suppressor. However, a translocation event is sometimes observed between this gene and the WWTR1 gene, with the resulting WWTR1-CAMTA1 oncoprotein leading to epithelioid hemangioendothelioma, a malignant vascular cancer. [provided by RefSeq, Mar 2017]
Transcript Variant: This variant (3) uses an alternate, 3' terminal exon compared to variant 1. This results in a shorter protein (isoform c, also known as 3) that lacks the ankyrin repeats and calmodulin-binding motifs, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...