APC16 (ANAPC16) (NM_001242547) Human Untagged Clone
CAT#: SC329987
ANAPC16 (untagged) - Homo sapiens anaphase promoting complex subunit 16 (ANAPC16), transcript variant 3
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | APC16; bA570G20.3; C10orf104; CENP-27; MSAG |
Vector | pCMV6-Entry |
Sequence Data |
>SC329987 representing NM_001242547.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCTGCTTCATCATCATCCTCCTCAGCTGGTGGGGTCAGTGGAAGTTCTGTCACTGGATCTGGTTTC AGTGTCTCAGACCTTGCCCCACCACGGAAAGCCCTTTTCACCTACCCCAAAGGAGCTGGAGAGATGTTA GAAGATGGCTCTGAGAGATTCCTCTGCGAATCTGTTTTTAGCTATCAAGTGGCATCCACGCTTAAACAG GTGAAACATGATCAGCAAGTTGCTCGGATGGAAAAACTAGCTGGTTTGGTAGAAGAGCTGGAGGCTGAC GAGTGGCGGTTTAAGCCCATCGAGCAGCTGCTGGGATTCACCCCCTCTTCAGGTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242547 |
Insert Size | 333 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001242547.1 |
RefSeq Size | 3186 bp |
RefSeq ORF | 333 bp |
Locus ID | 119504 |
UniProt ID | Q96DE5 |
MW | 11.7 kDa |
Gene Summary | Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1, and encodes isoform 1. Variants 1-3 encode the same protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231664 | ANAPC16 (Myc-DDK tagged) - Homo sapiens anaphase promoting complex subunit 16 (ANAPC16), transcript variant 3 |
CNY 1,200.00 |
|
RG231664 | ANAPC16 (tGFP-tagged) - Homo sapiens anaphase promoting complex subunit 16 (ANAPC16), transcript variant 3 |
CNY 4,370.00 |