MIF4GD (NM_001242501) Human Untagged Clone

CAT#: SC329974

MIF4GD (untagged) - Homo sapiens MIF4G domain containing (MIF4GD), transcript variant 4



  "NM_001242501" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
MIF4GD mouse monoclonal antibody, clone OTI4C11 (formerly 4C11)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AD023; MIFD; SLIP1
Vector pCMV6-Entry
Sequence Data
>SC329974 representing NM_001242501.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGGAGCCCAGTAGAGAGGAGTATAAAATCCAGTCCTTTGATGCAGAGACCCAGCAGCTGCTGAAG
ACAGCACTCAAAGATCCGGGTGCTGTGGACTTGGAGAAAGTGGCCAATGTGATTGTGGACCATTCTCTG
CAGGACTGTGTGTTCAGCAAGGAAGCAGGACGCATGTGCTACGCCATCATTCAGGCAGAGAGTAAACAA
GCAGGCCAGAGTGTCTTCCGACGTGGACTCCTCAACCGGCTGCAGCAGGAGTACCAGGCTCGGGAGCAG
CTGCGAGCACGCTCCCTGCAGGGCTGGGTCTGCTATGTCACCTTTATCTGCAACATCTTTGACTACCTG
AGGGTGAACAACATGCCCATGATGGCCCTGGTGAACCCTGTCTATGACTGCCTCTTCCGGCTGGCCCAG
CCAGACAGTTTGAGCAAGGAGGAGGAGGTGGACTGTTTGGTGCTGCAGCTGCACCGGGTTGGGGAGCAG
CTGGAGAAAATGAATGGGCAGCGCATGGATGAGCTCTTTGTGCTGATCCGGGATGGCTTCCTGCTCCCA
ACTGGCCTCAGCTCCCTGGCCCAGCTGCTGCTGCTGGAGATCATTGAGTTCCGGGCGGCCGGCTGGAAG
ACAACGCCAGCTGCCCACAAGTATTACTACAGCGAAGTCTCCGACTAG

Restriction Sites SgfI-MluI     
ACCN NM_001242501
Insert Size 669 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001242501.1
RefSeq Size 1262 bp
RefSeq ORF 669 bp
Locus ID 57409
UniProt ID A9UHW6
MW 25.4 kDa
Gene Summary This gene encodes a protein which interacts with the N-terminus of the stem-loop binding protein (SLBP) and the 3' end of histone mRNA. This interaction facilitates the activation of histone mRNA translation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
Transcript Variant: This variant (4), as well as variants 7-10, encodes isoform (4).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...