ANAPC13 (NM_001242374) Human Untagged Clone
CAT#: SC329941
ANAPC13 (untagged) - Homo sapiens anaphase promoting complex subunit 13 (ANAPC13), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | APC13; SWM1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329941 representing NM_001242374.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGACAGTGAGGTTCAGAGAGATGGAAGGATCTTGGATTTGATTGATGATGCTTGGCGAGAAGACAAG CTGCCTTATGAGGATGTCGCAATACCACTGAATGAGCTTCCTGAACCTGAACAAGACAATGGTGGCACC ACAGAATCTGTCAAAGAACAAGAAATGAAGTGGACAGACTTAGCCTTACAGTACCTCCATGAGAATGTT CCCCCCATTGGAAACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242374 |
Insert Size | 225 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001242374.1 |
RefSeq Size | 1859 bp |
RefSeq ORF | 225 bp |
Locus ID | 25847 |
UniProt ID | Q9BS18 |
Protein Pathways | Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis |
MW | 8.5 kDa |
Gene Summary | This gene encodes a component of the anaphase promoting complex, a large ubiquitin-protein ligase that controls cell cycle progression by regulating the degradation of cell cycle regulators such as B-type cyclins. The encoded protein is evolutionarily conserved and is required for the integrity and ubiquitin ligase activity of the anaphase promoting complex. Pseudogenes and splice variants have been found for this gene; however, the biological validity of some of the splice variants has not been determined. [provided by RefSeq, Nov 2008] Transcript Variant: This variant (2) represents the longest transcript. Variants 1, 2 and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231545 | ANAPC13 (Myc-DDK tagged) - Homo sapiens anaphase promoting complex subunit 13 (ANAPC13), transcript variant 2 |
CNY 1,200.00 |
|
RG231545 | ANAPC13 (tGFP-tagged) - Homo sapiens anaphase promoting complex subunit 13 (ANAPC13), transcript variant 2 |
CNY 4,370.00 |
其它ANAPC13产品