VNN2 (NM_001242350) Human Untagged Clone

CAT#: SC329931

VNN2 (untagged) - Homo sapiens vanin 2 (VNN2), transcript variant 5



  "NM_001242350" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


VNN2 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FOAP-4; GPI-80
Vector pCMV6-Entry
Sequence Data
>SC329931 representing NM_001242350.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTCACTTCCTCTTTTCCAATCTCTGTGGCAGTTTTTGCCCTAATAACCCTGCAGGTTGGTACTCAG
GACAGTTTTATAGCTGCAGTGTATGAACATGCTGTCATTTTGCCAAATAAAACAGAAACACCAGTTTCT
CAGGAGGATGCCTTGAATCTCATGAACGAGAATATAGACATTCTGGAGACAGCGATCAAGCAGGCAGCT
GAGCAGGGTGCTCGAATCATTGTGACTCCAGAAGATGCACTTTATGGATGGAAATTTACCAGGGAAACT
GTTTTCCCTTATCTGGAGGATATCCCAGACCCTCAGGTGAACTGGATTCCGTGTCAAGACCCCCACAGA
TTTGGTCACACACCAGTACAAGCAAGACTCAGCTGCCTGGCCAAGGACAACTCTATCTATGTCTTGGCA
AATTTGGGGGACAAAAAGCCATGTAATTCCCGTGACTCCACATGTCCTCCTAATGGCTACTTTCAATAC
AATACCAATGTGGTGTATAATACAGAAGGAAAACTCGTGGCACGTTACCATAAGGTCTGCACAATGCTG
AAGTGCAAAACTACTAATTTGACAACTTGTGGACGGCCAGTAGAAACTGCTTCTACAAGATTTGAAATG
TTCTCCCTCAGTGGCACATTTGGAACAGAGTATGTTTTTCCTGAAGTGCTACTTACCGAAATTCATCTG
TCACCTGGAAAATTTGAGGTGCTGAAAGATGGGCGTTTGGTAAACAAGAATGGATCATCTGGGCCTATA
CTAACAGTGTCACTCTTTGGGAGGTGGTACACAAAGGACTCACTTTACAGCTCATGTGGGACCAGCAAT
TCAGCAATAACTTACCTGCTAATATTCATATTATTAATGATCATAGCTTTGCAAAATATTGTAATGTTA
TAG

Restriction Sites SgfI-MluI     
ACCN NM_001242350
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001242350.2
RefSeq Size 1470 bp
RefSeq ORF 900 bp
Locus ID 8875
UniProt ID O95498
Protein Families Druggable Genome, Transmembrane
MW 33.3 kDa
Gene Summary This gene product is a member of the Vanin family of proteins that share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. The encoded protein is a GPI-anchored cell surface molecule that plays a role in transendothelial migration of neutrophils. This gene lies in close proximity to, and in same transcriptional orientation as two other vanin genes on chromosome 6q23-q24. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
Transcript Variant: This variant (5) lacks two alternate in-frame exons in the coding region, compared to variant 1. The resulting protein (isoform 3) is shorter but has the same N- and C-termini compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...