IL21 (NM_001207006) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	CVID11; IL-21; Za11
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC329883 representing NM_001207006. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAGATCCAGTCCTGGCAACATGGAGAGGATTGTCATCTGTCTGATGGTCATCTTCTTGGGGACACTG GTCCACAAATCAAGCTCCCAAGGTCAAGATCGCCACATGATTAGAATGCGTCAACTTATAGATATTGTT GATCAGCTGAAAAATTATGTGAATGACTTGGTCCCTGAATTTCTGCCAGCTCCAGAAGATGTAGAGACA AACTGTGAGTGGTCAGCTTTTTCCTGCTTTCAGAAGGCCCAACTAAAGTCAGCAAATACAGGAAACAAT GAAAGGATAATCAATGTATCAATTAAAAAGCTGAAGAGGAAACCACCTTCCACAAATGCAGGGAGAAGA CAGAAACACAGACTAACATGCCCTTCATGTGATTCTTATGAGAAAAAACCACCCAAAGAATTCCTAGAA AGATTCAAATCACTTCTCCAAAAGGTATCTACCTTAAGTTTCATTTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001207006
Insert Size	462 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001207006.2
RefSeq Size	707 bp
RefSeq ORF	462 bp
Locus ID	59067
UniProt ID	Q9HBE4
Protein Families	Druggable Genome, Secreted Protein
Protein Pathways	Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
MW	17.6 kDa
Gene Summary	This gene encodes a member of the common-gamma chain family of cytokines with immunoregulatory activity. The encoded protein plays a role in both the innate and adaptive immune responses by inducing the differentiation, proliferation and activity of multiple target cells including macrophages, natural killer cells, B cells and cytotoxic T cells. Dysregulation of this gene plays a role in multiple immune-mediated diseases including lupus, psoriasis and chronic inflammatory diseases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (2) retains an intron compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.