PPP2R2C (NM_001206995) Human Untagged Clone

CAT#: SC329879

PPP2R2C (untagged) - Homo sapiens protein phosphatase 2, regulatory subunit B, gamma (PPP2R2C), transcript variant 4



  "NM_001206995" in other vectors (2)

CNY 4,280.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PPP2R2C Antibody - N-terminal region
    • 50 ug

CNY 5,200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B55-GAMMA; B55gamma; IMYPNO; IMYPNO1; PR52; PR55G
Vector pCMV6-Entry
Sequence Data
>SC329879 representing NM_001206995.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCGTGAGGCGGACACGTTGAGGCCACCTCAGCTGATGGAAGTTTCCGCTGACATCATCTCTACCGTT
GAGTTCAACCACACGGGAGAGCTGCTGGCCACAGGTGACAAGGGCGGCCGGGTCGTCATCTTCCAGCGG
GAACCAGAGAGTAAAAATGCGCCCCACAGCCAGGGCGAATACGACGTGTACAGCACTTTCCAGAGCCAC
GAGCCGGAGTTTGACTATCTCAAGAGCCTGGAGATAGAGGAGAAGATCAACAAGATCAAGTGGCTCCCA
CAGCAGAACGCCGCCCACTCACTCCTGTCCACCAACGATAAAACTATCAAATTATGGAAGATTACCGAA
CGAGATAAAAGGCCCGAAGGATACAACCTGAAGGATGAAGAGGGGAAACTTAAGGACCTGTCCACGGTG
ACGTCACTGCAGGTGCCAGTGCTGAAGCCCATGGATCTGATGGTGGAGGTGAGCCCTCGGAGGATCTTT
GCCAATGGCCACACCTACCACATCAACTCCATCTCCGTCAACAGTGACTGCGAGACCTACATGTCGGCG
GATGACCTGCGCATCAACCTCTGGCACCTGGCCATCACCGACAGGAGCTTCAACATCGTGGACATCAAG
CCGGCCAACATGGAGGACCTTACGGAGGTGATCACAGCATCTGAGTTCCATCCGCACCACTGCAACCTC
TTCGTCTACAGCAGCAGCAAGGGCTCCCTGCGGCTCTGCGACATGCGGGCAGCTGCCCTGTGTGACAAG
CATTCCAAGCTCTTTGAAGAGCCTGAGGACCCCAGTAACCGCTCATTCTTCTCGGAAATCATCTCCTCC
GTGTCCGACGTGAAGTTCAGCCACAGCGGCCGCTACATGCTCACCCGGGACTACCTTACAGTCAAGGTC
TGGGACCTGAACATGGAGGCAAGACCCATAGAGACCTACCAGGTCCATGACTACCTTCGGAGCAAGCTC
TGTTCCCTGTACGAGAACGACTGCATTTTCGACAAGTTTGAATGTGCCTGGAACGGGAGCGACAGCGTC
ATCATGACCGGGGCCTACAACAACTTCTTCCGCATGTTCGATCGGAACACCAAGCGGGACGTGACCCTG
GAGGCCTCGAGGGAAAGCAGCAAGCCCCGGGCTGTGCTCAAGCCACGGCGCGTGTGCGTGGGGGGCAAG
CGCCGGCGTGATGACATCAGTGTGGACAGCTTGGACTTCACCAAGAAGATCCTGCACACGGCCTGGCAC
CCGGCTGAGAACATCATTGCCATCGCCGCCACCAACAACCTGTACATCTTCCAGGACAAGGTAAACTCT
GACATGCACTAG

Restriction Sites SgfI-MluI     
ACCN NM_001206995
Insert Size 1323 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001206995.1
RefSeq Size 4265 bp
RefSeq ORF 1323 bp
Locus ID 5522
UniProt ID Q9Y2T4
Protein Families Druggable Genome, Phosphatase
Protein Pathways Tight junction
MW 50.6 kDa
Gene Summary The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a gamma isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) contains alternate 5' exon structure, and it thus differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (c) has a distinct N-terminus and is shorter than isoform a. Both variants 3 and 4 encode isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...