AKT3 (NM_001206729) Human Untagged Clone

CAT#: SC329833

AKT3 (untagged) - Homo sapiens v-akt murine thymoma viral oncogene homolog 3 (AKT3), transcript variant 3



  "NM_001206729" in other vectors (2)

CN¥ 4,470.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
AKT3 mouse monoclonal antibody, clone OTI9B2 (formerly 9B2)
    • 100 ul

CN¥ 1,999.00
CN¥ 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MPPH; MPPH2; PKB-GAMMA; PKBG; PRKBG; RAC-gamma; RAC-PK-gamma; STK-2
Vector pCMV6-Entry
Sequence Data
>SC329833 representing NM_001206729.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGCGATGTTACCATTGTGAAAGAAGGTTGGGTTCAGAAGAGGGGAGAATATATAAAAAACTGGAGG
CCAAGATACTTCCTTTTGAAGACAGATGGCTCATTCATAGGATATAAAGAGAAACCTCAAGATGTGGAT
TTACCTTATCCCCTCAACAACTTTTCAGTGGCAAAATGCCAGTTAATGAAAACAGAACGACCAAAGCCA
AACACATTTATAATCAGATGTCTCCAGTGGACTACTGTTATAGAGAGAACATTTCATGTAGATACTCCA
GAGGAAAGGGAAGAATGGACAGAAGCTATCCAGGCTGTAGCAGACAGACTGCAGAGGCAAGAAGAGGAG
AGAATGAATTGTAGTCCAACTTCACAAATTGATAATATAGGAGAGGAAGAGATGGATGCCTCTACAACC
CATCATAAAAGAAAGACAATGAATGATTTTGACTATTTGAAACTACTAGGTAAAGGCACTTTTGGGAAA
GTTATTTTGGTTCGAGAGAAGGCAAGTGGAAAATACTATGCTATGAAGATTCTGAAGAAAGAAGTCATT
ATTGCAAAGGATGAAGTGGCACACACTCTAACTGAAAGCAGAGTATTAAAGAACACTAGACATCCCTTT
TTAACATCCTTGAAATATTCCTTCCAGACAAAAGACCGTTTGTGTTTTGTGATGGAATATGTTAATGGG
GGCGAGCTGTTTTTCCATTTGTCGAGAGAGCGGGTGTTCTCTGAGGACCGCACACGTTTCTATGGTGCA
GAAATTGTCTCTGCCTTGGACTATCTACATTCCGGAAAGATTGTGTACCGTGATCTCAAGTTGGAGAAT
CTAATGCTGGACAAAGATGGCCACATAAAAATTACAGATTTTGGACTTTGCAAAGAAGGGATCACAGAT
GCAGCCACCATGAAGACATTCTGTGGCACTCCAGAATATCTGGCACCAGAGGTGTTAGAAGATAATGAC
TATGGCCGAGCAGTAGACTGGTGGGGCCTAGGGGTTGTCATGTATGAAATGATGTGTGGGAGGTTACCT
TTCTACAACCAGGACCATGAGAAACTTTTTGAATTAATATTAATGGAAGACATTAAATTTCCTCGAACA
CTCTCTTCAGATGCAAAATCATTGCTTTCAGGGCTCTTGATAAAGGATCCAAATAAACGCCTTGGTGGA
GGACCAGATGATGCAAAAGAAATTATGAGACACAGTTTCTTCTCTGGAGTAAACTGGCAAGATGTATAT
GATAAAAAGCTTGTACCTCCTTTTAAACCTCAAGTAACATCTGAGACAGATACTAGATATTTTGATGAA
GAATTTACAGCTCAGACTATTACAATAACACCACCTGAAAAATGTCAGCAATCAGATTGTGGCATGCTG
GGTAACTGGAAAAAATAA

Restriction Sites SgfI-MluI     
ACCN NM_001206729
Insert Size 1398 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206729.1
RefSeq Size 1584 bp
RefSeq ORF 1398 bp
Locus ID 10000
UniProt ID Q9Y243
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Protein Kinase
Protein Pathways Acute myeloid leukemia, Adipocytokine signaling pathway, Apoptosis, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Glioma, Insulin signaling pathway, Jak-STAT signaling pathway, MAPK signaling pathway, Melanoma, mTOR signaling pathway, Neurotrophin signaling pathway, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Progesterone-mediated oocyte maturation, Prostate cancer, Renal cell carcinoma, Small cell lung cancer, T cell receptor signaling pathway, Tight junction, Toll-like receptor signaling pathway, VEGF signaling pathway
MW 54 kDa
Gene Summary The protein encoded by this gene is a member of the AKT, also called PKB, serine/threonine protein kinase family. AKT kinases are known to be regulators of cell signaling in response to insulin and growth factors. They are involved in a wide variety of biological processes including cell proliferation, differentiation, apoptosis, tumorigenesis, as well as glycogen synthesis and glucose uptake. This kinase has been shown to be stimulated by platelet-derived growth factor (PDGF), insulin, and insulin-like growth factor 1 (IGF1). Alternatively splice transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 3' UTR and 3' coding region, compared to variant 1. The resulting isoform (2) is shorter and has has a distinct C-terminus, compared to isoform 1. Variants 2 and 3 encode the same isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...