ATF7 (NM_001206683) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	ATFA
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC329829 representing NM_001206683. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGGAGACGACAGACCGTTTGTGTGCAATGCCCCGGGCTGTGGACAGAGATTTACAAACGAGGACCAC CTGGCAGTTCATAAACACAAGCATGAGATGACATTGAAATTTGGCCCAGCCCGAACTGACTCAGTCATC ATTGCAGATCAAACGCCTACTCCAACTAGATTCCTGAAGAACTGTGAGGAGGTGGGACTCTTCAATGAA CTAGCTAGCTCCTTTGAACATGAATTCAAGAAAGCTGCAGATGAGGATGAGAAAAAGGCAAGAAGCAGG ACTGTTGCCAAAAAACTGGTGGTATTCAGACCTAGGCTATTTTTATTGTGCTTTGGGATAATTTTCTTA ATTGGTTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001206683
Insert Size	354 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001206683.1
RefSeq Size	776 bp
RefSeq ORF	354 bp
Locus ID	11016
UniProt ID	P17544
Protein Families	Transcription Factors
MW	13.3 kDa
Gene Summary	Plays important functions in early cell signaling. Binds the cAMP response element (CRE) (consensus: 5'-GTGACGT[AG][AG]-3'), a sequence present in many viral and cellular promoters. Activator of the NF-ELAM1/delta-A site of the E-selectin promoter. Has no intrinsic transcriptional activity, but activates transcription on formation of JUN or FOS heterodimers. Also can bind TRE promoter sequences when heterodimerized with members of the JUN family.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (5) differs in the 5' UTR, 3' coding region and 3' UTR, compared to variant 2, resulting in an isoform (4) with a distinct and shorter C-terminus, compared to isoform 2. Variants 4, 5, and 13 all encode the same isoform (4).

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.