ATF7 (NM_001206682) Human Untagged Clone

CAT#: SC329828

ATF7 (untagged) - Homo sapiens activating transcription factor 7 (ATF7), transcript variant 4



  "NM_001206682" in other vectors (2)

CN¥ 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00


ATF7 rabbit polyclonal antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ATFA
Vector pCMV6-Entry
Sequence Data
>SC329828 representing NM_001206682.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGAGACGACAGACCGTTTGTGTGCAATGCCCCGGGCTGTGGACAGAGATTTACAAACGAGGACCAC
CTGGCAGTTCATAAACACAAGCATGAGATGACATTGAAATTTGGCCCAGCCCGAACTGACTCAGTCATC
ATTGCAGATCAAACGCCTACTCCAACTAGATTCCTGAAGAACTGTGAGGAGGTGGGACTCTTCAATGAA
CTAGCTAGCTCCTTTGAACATGAATTCAAGAAAGCTGCAGATGAGGATGAGAAAAAGGCAAGAAGCAGG
ACTGTTGCCAAAAAACTGGTGGTATTCAGACCTAGGCTATTTTTATTGTGCTTTGGGATAATTTTCTTA
ATTGGTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001206682
Insert Size 354 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206682.1
RefSeq Size 867 bp
RefSeq ORF 354 bp
Locus ID 11016
UniProt ID P17544
Protein Families Transcription Factors
MW 13.3 kDa
Gene Summary Plays important functions in early cell signaling. Binds the cAMP response element (CRE) (consensus: 5'-GTGACGT[AG][AG]-3'), a sequence present in many viral and cellular promoters. Activator of the NF-ELAM1/delta-A site of the E-selectin promoter. Has no intrinsic transcriptional activity, but activates transcription on formation of JUN or FOS heterodimers. Also can bind TRE promoter sequences when heterodimerized with members of the JUN family.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 3' coding region and 3' UTR, compared to variant 2, resulting in an isoform (4) with a distinct and shorter C-terminus, compared to isoform 2. Variants 4, 5, and 13 all encode the same isoform (4).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...