ATP5MD (NM_001206427) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	bA792D24.4; DAPIT; HCVFTP2; MC5DN6; USMG5
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC329808 representing NM_001206427. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCAGGTCCAGAAAGTGATGCGCAATACCAGTTCACTGGTATTAAAAAATATTTCAACTCTTATACT CTCACAGGTAGAATGAACTGTGTACTGGCCACATATGGAAGCATTGCATTGATTGTCTTATATTTCAAG TTAAGGTCCAAAAAAACTCCAGCTGTGAAAGCAACATAA
Restriction Sites	SgfI-MluI
ACCN	NM_001206427
Insert Size	177 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001206427.1
RefSeq Size	714 bp
RefSeq ORF	177 bp
Locus ID	84833
UniProt ID	Q96IX5
Protein Families	Transmembrane
MW	6.5 kDa
Gene Summary	Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation (Probable). Minor subunit required to maintain the ATP synthase population in the mitochondria (PubMed:21345788).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) has an additional exon in the 5' UTR and encodes the same protein, compared to variant 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.