RAD54B (NM_001205262) Human Untagged Clone
CAT#: SC329794
RAD54B (untagged) - Homo sapiens RAD54 homolog B (S. cerevisiae) (RAD54B), transcript variant 2
CN¥ 2,950.00
货期*
4周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RDH54 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329794 representing NM_001205262.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAGACGATCTGCAGCACCAAGTCAGTTGCAGGGGAATTCCTTCAAAAAACCAAAATTTATACCTCCA GGAAGAAGTAATCCAGGTCTGAATGAAGAGATTACAAAACTGAATCCAGATATAAAATTATTTGAGGGT GTTGCAATTAATAACACCTTTCTCCCGTCACAAAATGATCTTAGAATATGCAGTTTAAATCTGCCTAGT GAAGAAAGTACTAGAGAAATCAATAACAGAGATAATTGCAGTGGAAAATATTGTTTTGAAGCACCTACA CTGGCAACATTAGATCCACCTCATACAGTGCAAACTTGGATGAGGAGGCACAGGCTGGTACCAGTTCAC TACAGGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001205262 |
Insert Size | 354 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001205262.2 |
RefSeq Size | 5380 bp |
RefSeq ORF | 354 bp |
Locus ID | 25788 |
UniProt ID | O95073 |
Protein Families | Druggable Genome |
Protein Pathways | Homologous recombination |
MW | 13.3 kDa |
Gene Summary | The protein encoded by this gene belongs to the DEAD-like helicase superfamily. It shares similarity with Saccharomyces cerevisiae RAD54 and RDH54, both of which are involved in homologous recombination and repair of DNA. This protein binds to double-stranded DNA, and displays ATPase activity in the presence of DNA. This gene is highly expressed in testis and spleen, which suggests active roles in meiotic and mitotic recombination. Homozygous mutations of this gene were observed in primary lymphoma and colon cancer. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks several coding exons and uses an alternate 3' terminal exon, compared to variant 1. It encodes isoform 2, which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...