Occludin (OCLN) (NM_001205255) Human Untagged Clone

CAT#: SC329791

OCLN (untagged) - Homo sapiens occludin (OCLN), transcript variant 3



  "NM_001205255" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-OCLN Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BLCPMG; PPP1R115; PTORCH1
Vector pCMV6-Entry
Sequence Data
>SC329791 representing NM_001205255.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGATTATTGTGGCTTTTGCTTTAATAATTTTCTTTGCTGTGAAAACTCGAAGAAAGATGGACAGGTAT
GACAAGTCCAATATTTTGTGGGACAAGGAACACATTTATGATGAGCAGCCCCCCAATGTCGAGGAGTGG
GTTAAAAATGTGTCTGCAGGCACACAGGACGTGCCTTCACCCCCATCTGACTATGTGGAAAGAGTTGAC
AGTCCCATGGCATACTCTTCCAATGGCAAAGTGAATGACAAGCGGTTTTATCCAGAGTCTTCCTATAAA
TCCACGCCGGTTCCTGAAGTGGTTCAGGAGCTTCCATTAACTTCGCCTGTGGATGACTTCAGGCAGCCT
CGTTACAGCAGCGGTGGTAACTTTGAGACACCTTCAAAAAGAGCACCTGCAAAGGGAAGAGCAGGAAGG
TCAAAGAGAACAGAGCAAGATCACTATGAGACAGACTACACAACTGGCGGCGAGTCCTGTGATGAGCTG
GAGGAGGACTGGATCAGGGAATATCCACCTATCACTTCAGATCAACAAAGACAACTGTACAAGAGGAAT
TTTGACACTGGCCTACAGGAATACAAGAGCTTACAATCAGAACTTGATGAGATCAATAAAGAACTCTCC
CGTTTGGATAAAGAATTGGATGACTATAGAGAAGAAAGTGAAGAGTACATGGCTGCTGCTGATGAATAC
AATAGACTGAAGCAAGTGAAGGGATCTGCAGATTACAAAAGTAAGAAGAATCATTGCAAGCAGTTAAAG
AGCAAATTGTCACACATCAAGAAGATGGTTGGAGACTATGATAGACAGAAAACATAG

Restriction Sites SgfI-MluI     
ACCN NM_001205255
Insert Size 816 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001205255.1
RefSeq Size 5404 bp
RefSeq ORF 816 bp
Locus ID 100506658
UniProt ID Q16625
MW 31.6 kDa
Gene Summary This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5. [provided by RefSeq, Apr 2011]
Transcript Variant: This variant (3) lacks a portion of the 5' coding region and uses a downstream start codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a. The 5' UTR of this variant is incomplete due to a lack of 5'-complete transcripts containing this exon combination and the presence of splicing ambiguity at the 5' end. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...