ELOC (NM_001204861) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	SIII; TCEB1
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC329775 representing NM_001204861. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAATTGATATCA TCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGCACGATAAAAGCCATGTTG AGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTCAATTTTAGAGAGATACCTTCACATGTG CTATCGAAAGTATGCATGTATTTTACGTACAAGGTTCGCTACACTAACAGCTCCACCGAGATTCCTGAA TTCCCAATTGCACCTGAAATTGCACTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001204861
Insert Size	339 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001204861.1
RefSeq Size	2115 bp
RefSeq ORF	339 bp
Locus ID	6921
UniProt ID	Q15369
Protein Families	Druggable Genome, Transcription Factors
Protein Pathways	Pathways in cancer, Renal cell carcinoma, Ubiquitin mediated proteolysis
MW	12.5 kDa
Gene Summary	This gene encodes the protein elongin C, which is a subunit of the transcription factor B (SIII) complex. The SIII complex is composed of elongins A/A2, B and C. It activates elongation by RNA polymerase II by suppressing transient pausing of the polymerase at many sites within transcription units. Elongin A functions as the transcriptionally active component of the SIII complex, whereas elongins B and C are regulatory subunits. Elongin A2 is specifically expressed in the testis, and capable of forming a stable complex with elongins B and C. The von Hippel-Lindau tumor suppressor protein binds to elongins B and C, and thereby inhibits transcription elongation. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been identified. [provided by RefSeq, Mar 2011] Transcript Variant: This variant (6) differs in the 5' UTR compared to variant 1. Variants 1-7 encode the same protein (isoform a).

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.