ELOC (NM_001204858) Human Untagged Clone

CAT#: SC329772

TCEB1 (untagged) - Homo sapiens transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) (TCEB1), transcript variant 3



  "NM_001204858" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-TCEB1 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SIII; TCEB1
Vector pCMV6-Entry
Sequence Data
>SC329772 representing NM_001204858.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAATTGATATCA
TCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGCACGATAAAAGCCATGTTG
AGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTCAATTTTAGAGAGATACCTTCACATGTG
CTATCGAAAGTATGCATGTATTTTACGTACAAGGTTCGCTACACTAACAGCTCCACCGAGATTCCTGAA
TTCCCAATTGCACCTGAAATTGCACTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001204858
Insert Size 339 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001204858.1
RefSeq Size 2235 bp
RefSeq ORF 339 bp
Locus ID 6921
UniProt ID Q15369
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Pathways in cancer, Renal cell carcinoma, Ubiquitin mediated proteolysis
MW 12.5 kDa
Gene Summary This gene encodes the protein elongin C, which is a subunit of the transcription factor B (SIII) complex. The SIII complex is composed of elongins A/A2, B and C. It activates elongation by RNA polymerase II by suppressing transient pausing of the polymerase at many sites within transcription units. Elongin A functions as the transcriptionally active component of the SIII complex, whereas elongins B and C are regulatory subunits. Elongin A2 is specifically expressed in the testis, and capable of forming a stable complex with elongins B and C. The von Hippel-Lindau tumor suppressor protein binds to elongins B and C, and thereby inhibits transcription elongation. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
Transcript Variant: This variant (3) includes an alternate exon in the 5' UTR compared to variant 1. Variants 1-7 encode the same protein (isoform a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...