ANKS1B (NM_001204080) Human Untagged Clone
CAT#: SC329700
ANKS1B (untagged) - Homo sapiens ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), transcript variant 11
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AIDA; AIDA-1; ANKS2; cajalin-2; EB-1; EB1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329700 representing NM_001204080.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCAGGGCGATGCAAGGAGGAGAAGAAATGAAAACTACTTTGATGATATTCCCCGATCAAAACTGGAG AGGCAGATGGCTCAGACAGGAGACTGGGGAGAACCTTCCATTACCTTGCGACCTCCGAATGAAGCCACA GCCTCTACCCCGGTACAGTACTGGCAGCATCACCCAGAAAAGCTTATCTTCCAGTCGTGTGATTACAAA GCTTTTTATTTAGGTTCTATGCTGATAAAAGAGCTTAGGGGGACAGAATCAACCCAAGATGCTTGTGCA AAAATGCGGGCTAACTGTCAGAAGTCTACAGAGCAAATGAAGAAGGTCCCTACTATTATTCTTTCTGTC TCATATAAAGGAGTCAAATTTATTGATGCAACAAATAAGAACATAATTGCTGAGCATGAAATTCGTAAT ATCTCCTGTGCTGCCCAGGACCCAGAAGACCTCTCAACATTTGCCTATATCACAAAAGATTTGAAGTCT AATCACCACTACTGTCATGTGTTTACTGCCTTTGATGTGAATTTAGCCTATGAAATCATCCTAACCCTG GGACAGGCATTCGAAGTCGCTTACCAGCTAGCACTACAAGCAAGAAAAGGGGGACACTCCTCCACACTT CCAGAAAGCTTTGAAAACAAACCCTCCAAACCCATCCCCAAGCCCCGCGTTAGCATTCGCAAGTCCGTG CAGATCGACCCATCTGAGCAAAAGACTCTGGCCAATCTACCGTGGATTGTGGAGCCGGGCCAAGAAGCC AAGAGGGGCATTAATACCAAGTATGAAACCACGATTTTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204080 |
Insert Size | 801 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001204080.1 |
RefSeq Size | 3127 bp |
RefSeq ORF | 801 bp |
Locus ID | 56899 |
UniProt ID | Q7Z6G8 |
MW | 30.3 kDa |
Gene Summary | This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (11) differs in the 5' UTR and coding region and in the 3' UTR and coding region compared to variant 1. The resulting isoform (k) has a shorter and distinct N-terminus and a longer and distinct C-terminus compared to isoform a. Variants 11 and 39 both encode the same isoform (k). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232332 | ANKS1B (Myc-DDK tagged) - Homo sapiens ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), transcript variant 11 |
CNY 3,990.00 |
|
RG232332 | ANKS1B (tGFP-tagged) - Homo sapiens ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), transcript variant 11 |
CNY 4,370.00 |