BUD23 (NM_001202560) Human Untagged Clone

CAT#: SC329680

WBSCR22 (untagged) - Homo sapiens Williams Beuren syndrome chromosome region 22 (WBSCR22), transcript variant 1



  "NM_001202560" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal antibody to WBSCR22 (Williams Beuren syndrome chromosome region 22)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HASJ4442; HUSSY-3; MERM1; PP3381; WBMT; WBSCR22
Vector pCMV6-Entry
Sequence Data
>SC329680 representing NM_001202560.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGTCCCGCGGCCGGCGTCCGGAGCATGGCGGACCCCCAGAGCTGTTTTATGACGAGACAGAAGCC
CGGAAATACGTTCGCAACTCACGGATGATTGATATCCAGACCAGGATGGCTGGGCGAGCATTGGAGCTT
CTTTATCTGCCAGAGAATAAGCCCTGTTACCTGCTGGATATTGGCTGTGGCACTGGGCTGAGTGGAAGT
TATCTGTCAGATGAAGGGCACTATTGGGTGGGCCTGGATATCAGCCCTGCCATGCTGGATGAGGCTGTG
GACCGAGAGATAGAGGGAGACCTGCTGCTGGGGGATATGGGCCAGGGCATCCCATTCAAGCCAGGCACA
TTTGATGGTTGCATCAGCATTTCTGCTGTGCAGTGGCTCTGTAATGCTAACAAGAAGTCTGAAAACCCT
GCCAAGCGCCTGTACTGCTTTTTTGCTTCTCTTTTTTCTGTTCTCGTCCGGGGATCCCGAGCTGTCCTG
CAGCTGTACCCTGAGAACTCAGAGCAGTTGGAGCTGATCACAACCCAGGCCACAAAGGCAGGCTTCTCC
GGTGGCATGGTGGTAGACTACCCTAACAGTGCCAAAGCAAAGAAATTCTACCTCTGCTTGTTTTCTGGG
CCTTCGACCTTTATACCAGAGGGGCTGAGTGAAAATCAGGATGAAGTTGAACCCAGGGAGTCTGTGTTC
ACCAATGAGAGGGAAGGTGGAGCATTTGAGAGAAGGGGCATCCGAGGCCACCAGACTCGGAGGTTCCCA
TTAAGGATGTCGAGGCGGGGAATGGTGAGGAAGAGTCGGGCATGGGTGCTGGAGAAGAAGGAGCGGCAC
AGGCGCCAGGGCAGGGAAGTCAGACCTGACACCCAGTACACCGGCCGCAAGCGCAAGCCCCGCTTCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001202560
Insert Size 897 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001202560.2
RefSeq Size 1307 bp
RefSeq ORF 897 bp
Locus ID 114049
UniProt ID O43709
Protein Families Druggable Genome
Protein Pathways Androgen and estrogen metabolism, Histidine metabolism, Selenoamino acid metabolism, Tyrosine metabolism
MW 33.8 kDa
Gene Summary This gene encodes a protein containing a nuclear localization signal and an S-adenosyl-L-methionine binding motif typical of methyltransferases, suggesting that the encoded protein may act on DNA methylation. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternatively spliced transcript variants have been found. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...