UBE2E1 (NM_001202476) Human Untagged Clone

CAT#: SC329663

UBE2E1 (untagged) - Homo sapiens ubiquitin-conjugating enzyme E2E 1 (UBE2E1), transcript variant 3



  "NM_001202476" in other vectors (2)

CN¥ 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal UBCH6 Antibody
    • 100 ul

CN¥ 5,381.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms UBCH6
Vector pCMV6-Entry
Sequence Data
>SC329663 representing NM_001202476.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAGGAAGTGGGCAGACCCCGGGAAGTTAGAGGACGCCCGGGGAAAAGCAGAATTCAGAAGGAGCTG
GCGGACATCACTTTAGACCCTCCACCTAATTGCAGTGCTGGTCCCAAAGGCGATAACATCTATGAATGG
AGATCAACCATTCTAGGGCCTCCAGGATCCGTGTATGAGGGTGGTGTATTCTTTCTCGATATCACTTTT
ACACCAGAATATCCCTTCAAGCCTCCAAAGGTTACATTTCGGACAAGAATCTATCATTGTAATATTAAC
AGTCAAGGTGTTATTTGCTTGGACATATTGAAAGATAATTGGAGTCCAGCACTAACCATTTCTAAAGTC
CTCCTTTCTATCTGCTCACTTCTTACAGACTGTAATCCTGCCGACCCCTTGGTGGGAAGTATTGCCACT
CAGTATATGACCAACAGAGCAGAACATGACAGAATGGCCAGACAGTGGACCAAGAGATACGCTACATAA

Restriction Sites SgfI-MluI     
ACCN NM_001202476
Insert Size 483 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001202476.1
RefSeq Size 1550 bp
RefSeq ORF 483 bp
Locus ID 7324
UniProt ID P51965
Protein Pathways Ubiquitin mediated proteolysis
MW 18 kDa
Gene Summary The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (3) lacks two exons from the 5' end and has an alternate 5' exon, as comapred to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...