SEM1 (NM_001201450) Human Untagged Clone

CAT#: SC329621

C7orf76 (untagged) - Homo sapiens chromosome 7 open reading frame 76 (C7orf76), transcript variant 1



  "NM_001201450" in other vectors (2)

CN¥ 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C7orf76; DSS1; ECD; SHFD1; Shfdg1; SHFM1; SHSF1
Vector pCMV6-Entry
Sequence Data
>SC329621 representing NM_001201450.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTATTGCCAGGACTCCAACATTTGTGCTGTGTTTGCTGTACAAGGAGGAAAAGTGGGAAGAAAGCAT
GGCATAAAAAGGGGGAGGAGACCCAGCATAAGAAGCCCAGCTCAGCGGGCCAGAGGACCCTGGATCCAT
GAGAGTAAGCATCCGGCCTTTGCAAAGCAACAGATAAACTTGGAGATGCCCAACTCCAGAGCGACAACA
GAGTTAGCCTGGGTCTGCAGCTCCACCTCAAGAAAAAAGAAGTGGGCAAGGTCCCTGACTCTTTCCACT
GCTCCACTGAGCCCCCCACCATCCTTGGTGCACTGTGAAGATTGTTCTTGCCTGCCTGGCTGCCATTCG
GGTGACCTCTACAATCTGGCCCCAGCAGAAAGAACTTGCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001201450
Insert Size 387 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001201450.1
RefSeq Size 2707 bp
RefSeq ORF 387 bp
Locus ID 7979
Protein Pathways Homologous recombination, Proteasome
MW 14.1 kDa
Gene Summary The product of this gene has been localized within the split hand/split foot malformation locus SHFM1 at chromosome 7. It has been proposed to be a candidate gene for the autosomal dominant form of the heterogeneous limb developmental disorder split hand/split foot malformation type 1. In addition, it has been shown to directly interact with BRCA2. It also may play a role in the completion of the cell cycle. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (6) represents the use of an alternate promoter, resulting in a different 5' UTR and use of an alternate start codon, compared to variant 1. It encodes isoform 4, which is longer and has a distinct N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...