SESN1 (NM_001199933) Human Untagged Clone

CAT#: SC329595

SESN1 (untagged) - Homo sapiens sestrin 1 (SESN1), transcript variant 2



  "NM_001199933" in other vectors (2)

CNY 4,660.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
Rabbit polyclonal anti-SESN1 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PA26; SEST1
Vector pCMV6-Entry
Sequence Data
>SC329595 representing NM_001199933.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCGCTTGGCCGCCGCCGCGAACGAGGCGTACACGGCCCCTTTGGCGGTCTCGGGGCTGCTGGGCTGC
AAGCAGTGCGGCGGGGGCCGCGACCAGGACGAGGAACTTGGCATTAGAATTCCTCGACCACTAGGACAG
GGACCAAGCAGATTCATCCCAGAAAAGGAGATCCTCCAAGTGGGGAGTGAAGACGCACAGATGCATGCT
TTATTTGCAGATTCTTTTGCTGCTTTGGGCCGTTTGGATAACATTACGTTAGTGATGGTTTTCCACCCA
CAATATTTAGAAAGTTTCTTAAAAACTCAGCACTATCTACTGCAAATGGATGGGCCGTTACCCCTACAT
TATCGTCACTACATTGGAATAATGGCTGCGGCAAGACATCAGTGCTCCTACTTAGTGAACCTGCATGTA
AATGATTTCCTTCATGTTGGTGGGGACCCCAAGTGGCTCAATGGTTTAGAGAATGCTCCTCAAAAACTA
CAGAATTTAGGAGAACTTAACAAAGTGTTAGCCCATAGACCTTGGCTTATTACCAAAGAACACATTGAG
GGACTTTTAAAAGCTGAAGAGCACAGCTGGTCCCTTGCGGAATTGGTACATGCAGTAGTTTTACTCACA
CACTATCATTCTCTTGCCTCATTCACATTCGGCTGTGGAATCAGTCCAGAAATTCATTGTGATGGTGGC
CACACATTCAGACCTCCTTCTGTTAGCAACTACTGCATCTGTGACATTACAAATGGCAATCACAGTGTG
GATGAGATGCCGGTCAACTCAGCAGAAAATGTTTCTGTAAGTGATTCTTTCTTTGAGGTTGAAGCCCTC
ATGGAAAAGATGAGGCAGTTACAGGAATGTCGAGATGAAGAAGAGGCAAGTCAGGAAGAGATGGCTTCA
CGTTTTGAAATAGAAAAAAGAGAGAGTATGTTTGTCTTCTCTTCAGATGATGAAGAAGTTACACCAGCA
AGAGCTGTATCTCGTCATTTTGAGGATACTAGTTATGGCTATAAAGATTTCTCTAGACATGGGATGCAT
GTTCCAACATTTCGTGTCCAGGACTATTGCTGGGAAGATCATGGTTATTCTTTGGTAAATCGCCTTTAT
CCAGATGTGGGACAGTTGATTGATGAAAAATTTCACATTGCTTACAATCTTACTTATAATACAATGGCA
ATGCACAAAGATGTTGATACCTCAATGCTTAGACGGGCAATTTGGAACTATATTCACTGCATGTTTGGA
ATAAGATATGATGATTATGACTATGGTGAAATTAACCAGCTATTGGATCGTAGCTTTAAAGTTTATATC
AAAACTGTTGTTTGCACTCCTGAAAAGGTTACCAAAAGAATGTATGATAGCTTCTGGAGGCAGTTCAAG
CACTCTGAGAAGGTTCATGTTAATCTGCTTCTTATAGAAGCTAGGATGCAAGCAGAACTCCTTTATGCT
CTGAGAGCCATTACCCGCTATATGACCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001199933
Insert Size 1479 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199933.1
RefSeq Size 2698 bp
RefSeq ORF 1479 bp
Locus ID 27244
UniProt ID Q9Y6P5
Protein Pathways p53 signaling pathway
MW 56.6 kDa
Gene Summary This gene encodes a member of the sestrin family. Sestrins are induced by the p53 tumor suppressor protein and play a role in the cellular response to DNA damage and oxidative stress. The encoded protein mediates p53 inhibition of cell growth by activating AMP-activated protein kinase, which results in the inhibition of the mammalian target of rapamycin protein. The encoded protein also plays a critical role in antioxidant defense by regenerating overoxidized peroxiredoxins, and the expression of this gene is a potential marker for exposure to radiation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...