Kv beta 2 (KCNAB2) (NM_001199863) Human Untagged Clone

CAT#: SC329583

KCNAB2 (untagged) - Homo sapiens potassium voltage-gated channel, shaker-related subfamily, beta member 2 (KCNAB2), transcript variant 6



  "NM_001199863" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal Anti-KCNAB2 Antibody
    • 50 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AKR6A5; HKvbeta2; HKvbeta2.1; HKvbeta2.2; KCNA2B; KV-BETA-2
Vector pCMV6-Entry
Sequence Data
>SC329583 representing NM_001199863.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGAGCAGCTCATGACCTTGGCCTATGATAATGGCATCAACCTCTTCGATACAGCAGAAGTCTAC
GCAGCCGGCAAGGCTGAAGTGGTACTGGGAAACATCATTAAGAAGAAAGGATGGAGGCGGTCCAGCCTC
GTCATCACCACCAAGATCTTCTGGGGCGGAAAGGCGGAGACGGAGCGGGGCCTGTCCAGGAAGCACATA
ATCGAAGGTCTGAAAGCTTCCCTGGAGCGACTGCAGCTGGAGTACGTGGATGTGGTGTTTGCCAACCGC
CCGGACCCCAACACCCCGATGGAAGAGACCGTCCGCGCCATGACCCACGTCATCAACCAGGGGATGGCC
ATGTACTGGGGCACGTCACGCTGGAGCTCCATGGAGATCATGGAGGCCTACTCCGTGGCCCGGCAGTTC
AACCTGACCCCGCCCATCTGCGAGCAGGCTGAGTACCACATGTTCCAGCGTGAGAAAGTGGAGGTGCAG
CTGCCGGAGCTGTTCCACAAGATAGGAGTGGGCGCCATGACCTGGTCCCCTCTGGCCTGTGGCATTGTT
TCTGGCAAGTACGACAGTGGCATCCCACCCTACTCAAGAGCCTCCTTGAAGGGCTACCAGTGGCTGAAG
GACAAGATCCTCAGTGAGGAGGGCCGGCGCCAGCAAGCCAAGCTGAAGGAGCTGCAGGCCATCGCCGAG
CGCCTGGGCTGCACCCTGCCCCAGCTGGCCATAGCCTGGTGCCTGAGGAATGAGGGAGTCAGCTCCGTG
CTCCTGGGGGCCTCCAATGCGGACCAGCTCATGGAGAACATTGGGGCAATACAGGTCCTTCCGAAACTG
TCATCTTCCATTATCCACGAGATTGATAGTATTTTGGGCAATAAACCCTACAGCAAAAAGGACTACAGA
TCCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001199863
Insert Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199863.1
RefSeq Size 3690 bp
RefSeq ORF 903 bp
Locus ID 8514
UniProt ID Q13303
Protein Families Druggable Genome, Ion Channels: Other
MW 33.7 kDa
Gene Summary Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member is one of the beta subunits, which are auxiliary proteins associating with functional Kv-alpha subunits. This member alters functional properties of the KCNA4 gene product. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (6) lacks three exons from the 5' end and contains an alternate 5' exon, resulting in a downstream AUG start codon, as compared to variant 1. The resulting isoform (4) has a shorter N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...