AK3 (NM_001199852) Human Untagged Clone

CAT#: SC329576

AK3 (untagged) - Homo sapiens adenylate kinase 3 (AK3), transcript variant 2



  "NM_001199852" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


AK3 mouse monoclonal antibody, clone OTI5A1 (formerly 5A1)
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AK3L1; AK6; AKL3L; AKL3L1; FIX
Vector pCMV6-Entry
Sequence Data
>SC329576 representing NM_001199852.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGGCGTCCGCGCGGCTGCTGCGAGCGGTGATCATGGGGGCCCCGGGCTCGGGCAAGGGCACCGTG
TCGTCGCGCATCACTACACACTTCGAGCTGAAGCACCTCTCCAGCGGGGACCTGCTCCGGGACAACATG
CTGCGGGGCACAGGTTTTCCAAGGACACTTCCACAGGCAGAAGCCCTAGATAGAGCTTATCAGATCGAC
ACAGTGATTAACCTGAATGTGCCCTTTGAGGTCATTAAACAACGCCTTACTGCTCGCTGGATTCATCCC
GCCAGTGGCCGAGTCTATAACATTGAATTCAACCCTCCCAAAACTGTGGGCATTGATGACCTGACTGGG
GAGCCTCTCATTCAGCGTGAGGATGATAAACCAGAGACGGTTATCAAGAGACTAAAGGCTTATGAAGAC
CAAACAAAGCCAGTCCTGGAATATTACCAGAAAAAAGGGGTGCTGGAAACATTCTCCGGAACAGAAACC
AACAAGATTTGGCCCTATGTATATGCTTTCCTACAAACTAAAGTTCCACAAAGAAGCCAGAAAGCTTCA
GTTACTCCATGA

Restriction Sites SgfI-MluI     
ACCN NM_001199852
Insert Size 564 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199852.1
RefSeq Size 4213 bp
RefSeq ORF 564 bp
Locus ID 50808
UniProt ID Q9UIJ7
Protein Families Druggable Genome
Protein Pathways Pyrimidine metabolism
MW 21 kDa
Gene Summary The protein encoded by this gene is a GTP:ATP phosphotransferase that is found in the mitochondrial matrix. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...