GGCT (NM_001199817) Human Untagged Clone
CAT#: SC329571
GGCT (untagged) - Homo sapiens gamma-glutamylcyclotransferase (GGCT), transcript variant 4
CNY 2,950.00
货期*
4周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C7orf24; CRF21; GCTG; GGC |
Vector | pCMV6-Entry |
Sequence Data |
>SC329571 representing NM_001199817.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCCAACTCGGGCTGCAAGGACGTCACGGGTCCAGATGAGGAGAGTTTTCTGTACTTTGCCTACGGC AGCAACCTGCTGACAGAGAGGATCCACCTCCGAAACCCCTCGGCGGCGTTCTTCTGTGTGGCCCGCCTG CAGATTATTTGCATGGGTGCAAAAGAAAATGGTTTGCCGCTGGAGTATCAAGAGAAGTTAAAAGCAATA GAACCAAATGACTATACAGGAAAGGTCTCAGAAGAAATTGAAGACATCATCAAAAAGGGGGAAACACAA ACTCTTTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199817 |
Insert Size | 285 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001199817.1 |
RefSeq Size | 915 bp |
RefSeq ORF | 285 bp |
Locus ID | 79017 |
UniProt ID | O75223 |
Protein Pathways | Glutathione metabolism |
MW | 10.5 kDa |
Gene Summary | The protein encoded by this gene catalyzes the formation of 5-oxoproline from gamma-glutamyl dipeptides, the penultimate step in glutathione catabolism, and may play a critical role in glutathione homeostasis. The encoded protein may also play a role in cell proliferation, and the expression of this gene is a potential marker for cancer. Pseudogenes of this gene are located on the long arm of chromosome 5 and the short arm of chromosomes 2 and 20. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (4) lacks multiple exons in the coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform 4, which is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...