ARL2 (NM_001199745) Human Untagged Clone

CAT#: SC329555

ARL2 (untagged) - Homo sapiens ADP-ribosylation factor-like 2 (ARL2), transcript variant 2



  "NM_001199745" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-ARL2 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARFL2
Vector pCMV6-Entry
Sequence Data
>SC329555 representing NM_001199745.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGCTCCTGACCATTCTGAAGAAGATGAAGCAGAAAGAGCGGGAGCTGCGACTGCTCATGCTTGGC
CTGGACAATGCTGGAAAGACAACCATCCTGAAGAAGTTCAATGGGGAGGACATCGACACCATCTCCCCA
ACGCTGGGCTTCAACATCAAGACCCTGGAGCACCGAGGATTCAAGCTGAACATCTGGGATGTGGGTGGC
CAGAAGTCCCTGCGGTCCTACTGGCGGAACTACTTTGAGAGCACCGATGGCCTCATCTGGGTAGTGGAC
AGCGCAGACCGCCAGCGCATGCAGGACTGCCAGCGGGAGCTCCAGAGCCTGCTGGTGGAGGAGGTCCTG
GAGCTGGACTCCATCCGCAGCCACCACTGGTGCATCCAGGGCTGCAGCGCCGTCACCGGGGAGAACCTG
CTGCCGGGCATCGACTGGCTCCTGGATGACATTTCCAGCCGCATTTTCACAGCTGACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001199745
Insert Size 474 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199745.1
RefSeq Size 912 bp
RefSeq ORF 474 bp
Locus ID 402
UniProt ID P36404
MW 18.1 kDa
Gene Summary This gene encodes a small GTP-binding protein of the RAS superfamily which functions as an ADP-ribosylation factor (ARF). The encoded protein is one of a functionally distinct group of ARF-like genes. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...