TGF beta induced factor 2 (TGIF2) (NM_001199513) Human Untagged Clone

CAT#: SC329527

TGIF2 (untagged) - Homo sapiens TGFB-induced factor homeobox 2 (TGIF2), transcript variant 3



  "NM_001199513" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal TGF beta induced factor 2 Antibody
    • 100 ug

CNY 5,302.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC329527 representing NM_001199513.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCGGACAGTGATCTAGGTGAGGACGAAGGCCTCCTCTCCCTGGCGGGCAAAAGGAAGCGCAGGGGG
AACCTGCCCAAGGAGTCGGTGAAGATCCTCCGGGACTGGCTGTACTTGCACCGCTACAACGCCTACCCC
TCAGAGCAGGAGAAGCTGAGCCTTTCTGGACAGACCAACCTGTCAGTGCTGCAAATATGTAACTGGTTC
ATCAATGCCCGGCGGCGGCTTCTCCCAGACATGCTTCGGAAGGATGGCAAAGACCCTAATCAGTTTACC
ATTTCCCGCCGCGGGGGTAAGGCCTCAGATGTGGCCCTCCCCCGTGGCAGCAGCCCCTCAGTGCTGGCT
GTGTCTGTCCCAGCCCCCACCAATGTGCTCTCCCTGTCTGTGTGCTCCATGCCGCTTCACTCAGGCCAG
GGGGAAAAGCCAGCAGCCCCTTTCCCACGTGGGGAGCTGGAGTCTCCCAAGCCCCTGGTGACCCCTGGT
AGCACACTTACTCTGCTGACCAGGGCTGAGGCTGGAAGCCCCACAGGTGGACTCTTCAACACGCCACCA
CCCACACCCCCAGAGCAGGACAAAGAGGACTTCAGCAGCTTCCAGCTGCTGGTGGAGGTGGCGCTACAG
AGGGCTGCTGAGATGGAGCTTCAGAAGCAGCAGGACCCATCACTCCCATTACTGCACACTCCCATCCCT
TTAGTCTCTGAAAATCCCCAGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001199513
Insert Size 714 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199513.1
RefSeq Size 3328 bp
RefSeq ORF 714 bp
Locus ID 60436
UniProt ID Q9GZN2
Protein Families Transcription Factors
MW 25.9 kDa
Gene Summary The protein encoded by this gene is a DNA-binding homeobox protein and a transcriptional repressor, which appears to repress transcription by recruiting histone deacetylases to TGF beta-responsive genes. This gene is amplified and over-expressed in some ovarian cancers. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 1. Read-through transcription also exists between this gene and the neighboring downstream C20orf24 (chromosome 20 open reading frame 24) gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. All variants (1-4) encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它TGF beta induced factor 2产品

Customer Reviews 
Loading...