GNGT2 (NM_001198755) Human Untagged Clone
CAT#: SC329472
GNGT2 (untagged) - Homo sapiens guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 (GNGT2), transcript variant 3
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | G-GAMMA-8; G-GAMMA-C; GNG9; GNGT8 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329472 representing NM_001198755.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCCCAGGATCTCAGCGAGAAGGACCTGTTGAAGATGGAGGTGGAGCAGCTGAAGAAAGAAGTGAAA AACACAAGAATTCCGATTTCCAAAGCGGGAAAGGAAATCAAGGAGTACGTGGAGGCCCAAGCAGGAAAC GATCCTTTTCTCAAAGGCATCCCTGAGGACAAGAATCCCTTCAAGGAGAAAGGTGGCTGTCTGATAAGC TGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001198755 |
Insert Size | 210 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001198755.1 |
RefSeq Size | 1040 bp |
RefSeq ORF | 210 bp |
Locus ID | 2793 |
UniProt ID | O14610 |
Protein Families | Druggable Genome |
Protein Pathways | Chemokine signaling pathway |
MW | 7.7 kDa |
Gene Summary | Phototransduction in rod and cone photoreceptors is regulated by groups of signaling proteins. The encoded protein is thought to play a crucial role in cone phototransduction. It belongs to the G protein gamma family and localized specifically in cones. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2010] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. All four variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231533 | GNGT2 (Myc-DDK tagged) - Homo sapiens guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 (GNGT2), transcript variant 3 |
CNY 1,200.00 |
|
RG231533 | GNGT2 (tGFP-tagged) - Homo sapiens guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 (GNGT2), transcript variant 3 |
CNY 4,370.00 |