CGGBP1 (NM_001195308) Human Untagged Clone

CAT#: SC329452

CGGBP1 (untagged) - Homo sapiens CGG triplet repeat binding protein 1 (CGGBP1), transcript variant 3



  "NM_001195308" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-CGGBP1 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGGBP; p20-CGGBP
Vector pCMV6-Entry
Sequence Data
>SC329452 representing NM_001195308.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGCGATTTGTAGTAACAGCACCACCTGCTCGAAACCGTTCTAAGACTGCTTTGTATGTGACTCCC
CTGGATCGAGTCACTGAGTTTGGAGGTGAGCTGCATGAAGATGGAGGAAAACTCTTCTGCACTTCTTGC
AATGTGGTTCTGAATCATGTTCGCAAGTCTGCCATTAGTGACCACCTCAAGTCAAAGACTCATACCAAG
AGGAAGGCAGAATTTGAAGAGCAGAATGTGAGAAAGAAGCAGAGGCCCCTAACTGCATCTCTTCAGTGC
AACAGTACTGCGCAAACAGAGAAAGTCAGTGTTATCCAGGACTTTGTGAAAATGTGCCTGGAAGCCAAC
ATCCCACTTGAGAAGGCTGATCACCCAGCAGTCCGTGCTTTCCTATCTCGCCATGTGAAGAATGGAGGC
TCCATACCTAAGTCAGACCAGCTACGGAGGGCATATCTTCCTGATGGATATGAGAATGAGAATCAACTC
CTCAACTCACAAGATTGTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001195308
Insert Size 504 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001195308.1
RefSeq Size 4589 bp
RefSeq ORF 504 bp
Locus ID 8545
UniProt ID Q9UFW8
MW 18.8 kDa
Gene Summary This gene encodes a CGG repeat-binding protein that primarily localizes to the nucleus. CGG trinucleotide repeats are implicated in many disorders as they often act as transcription- and translation-regulatory elements, can produce hairpin structures which cause DNA replication errors, and form regions prone to chromosomal breakage. CGG repeats are also targets for CpG methylation. In addition to its ability to bind CGG repeats and regulate transcription, this gene is believed to play a role in DNA damage repair and telomere protection. In vitro studies indicate this protein does not bind to methylated CpG sequences. [provided by RefSeq, Jul 2017]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. All three variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...