C1D (NM_001190265) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	hC1D; LRP1; Rrp47; SUN-CoR; SUNCOR
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC329417 representing NM_001190265. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCAGGTGAAGAAATTAATGAAGACTATCCAGTAGAAATTCACGAGTATTTGTCAGCGTTTGAGAAT TCCATTGGTGCTGTGGATGAGATGCTGAAGACCATGATGTCTGTTTCTAGAAATGAGTTGTTGCAGAAG TTGGATCCACTTGAACAAGCAAAAGTGGATTTGGTTTCTGCATACACATTAAATTCAATGTTTTGGGTT TATTTGGCAACCCAAGGAGTTAATCCTAAGGAACATCCAGTAAAACAGGAATTGGAAAGAATCAGAGTA TATATGAACAGAGTCAAGGAAATAACAGACAAGAAAAAGGCTGGCAAGCTGGACAGAGGTGCAGCTTCA AGATTTGTAAAAAATGCCCTCTGGGAACCAAAATCGAAAAATGCATCAAAAGTTGCCAATAAAGGAAAA AGTAAAAGTTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001190265
Insert Size	426 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001190265.1
RefSeq Size	1294 bp
RefSeq ORF	426 bp
Locus ID	10438
UniProt ID	Q13901
Protein Families	Druggable Genome
Protein Pathways	RNA degradation
MW	16 kDa
Gene Summary	The protein encoded by this gene is a DNA binding and apoptosis-inducing protein and is localized in the nucleus. It is also a Rac3-interacting protein which acts as a corepressor for the thyroid hormone receptor. This protein is thought to regulate TRAX/Translin complex formation. Alternate splicing results in multiple transcript variants that encode the same protein. Multiple pseudogenes of this gene are found on chromosome 10.[provided by RefSeq, Jun 2010] Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3 and 4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.