Glucose 6 phosphate isomerase (GPI) (NM_001184722) Human Untagged Clone

CAT#: SC328930

GPI (untagged)-Human glucose-6-phosphate isomerase (GPI) transcript variant 1



  "NM_001184722" in other vectors (6)

CNY 6,368.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
Anti-GPI (Glucose 6 phosphate isomerase) mouse monoclonal antibody, clone OTI2D2 (formerly 2D2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AMF; GNPI; NLK; PGI; PHI; SA-36; SA36
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328930 representing NM_001184722.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTAGCTCTCTGCAGCCTCCAACACCTGGGCTCCAGTGATCCCCGGGCTCTGCCCACCCTCCCCACT
GCCACTTCCGGGCAGAGGCCAGCAAAGCGGCGGCGCAAGAGTCCCGCCATGGCCGCTCTCACCCGGGAC
CCCCAGTTCCAGAAGCTGCAGCAATGGTACCGCGAGCACCGCTCCGAGCTGAACCTGCGCCGCCTCTTC
GATGCCAACAAGGACCGCTTCAACCACTTCAGCTTGACCCTCAACACCAACCATGGGCATATCCTGGTG
GATTACTCCAAGAACCTGGTGACGGAGGACGTGATGCGGATGCTGGTGGACTTGGCCAAGTCCAGGGGC
GTGGAGGCCGCCCGGGAGCGGATGTTCAATGGTGAGAAGATCAACTACACCGAGGGTCGAGCCGTGCTG
CACGTGGCTCTGCGGAACCGGTCAAACACACCCATCCTGGTAGACGGCAAGGATGTGATGCCAGAGGTC
AACAAGGTTCTGGACAAGATGAAGTCTTTCTGCCAGGGACCCCTCATGGTGACTGAAGCCCTTAAGCCA
TACTCTTCAGGAGGTCCCCGCGTCTGGTATGTCTCCAACATTGATGGAACTCACATTGCCAAAACCCTG
GCCCAGCTGAACCCCGAGTCCTCCCTGTTCATCATTGCCTCCAAGACCTTTACTACCCAGGAGACCATC
ACGAATGCAGAGACGGCGAAGGAGTGGTTTCTCCAGGCGGCCAAGGATCCTTCTGCAGTGGCGAAGCAC
TTTGTTGCCCTGTCTACTAACACAACCAAAGTGAAGGAGTTTGGAATTGACCCTCAAAACATGTTCGAG
TTCTGGGATTGGGTGGGAGGACGCTACTCGCTGTGGTCGGCCATCGGACTCTCCATTGCCCTGCACGTG
GGTTTTGACAACTTCGAGCAGCTGCTCTCGGGGGCTCACTGGATGGACCAGCACTTCCGCACGACGCCC
CTGGAGAAGAACGCCCCCGTCTTGCTGGCCCTGCTGGGTATCTGGTACATCAACTGCTTTGGGTGTGAG
ACACACGCCATGCTGCCCTATGACCAGTACCTGCACCGCTTTGCTGCGTACTTCCAGCAGGGCGACATG
GAGTCCAATGGGAAATACATCACCAAATCTGGAACCCGTGTGGACCACCAGACAGGCCCCATTGTGTGG
GGGGAGCCAGGGACCAATGGCCAGCATGCTTTTTACCAGCTCATCCACCAAGGCACCAAGATGATACCC
TGTGACTTCCTCATCCCGGTCCAGACCCAGCACCCCATACGGAAGGGTCTGCATCACAAGATCCTCCTG
GCCAACTTCTTGGCCCAGACAGAGGCCCTGATGAGGGGAAAATCGACGGAGGAGGCCCGAAAGGAGCTC
CAGGCTGCGGGCAAGAGTCCAGAGGACCTTGAGAGGCTGCTGCCACATAAGGTCTTTGAAGGAAATCGC
CCAACCAACTCTATTGTGTTCACCAAGCTCACACCATTCATGCTTGGAGCCTTGGTCGCCATGTATGAG
CACAAGATCTTCGTTCAGGGCATCATCTGGGACATCAACAGCTTTGACCAGTGGGGAGTGGAGCTGGGA
AAGCAGCTGGCTAAGAAAATAGAGCCTGAGCTTGATGGCAGTGCTCAAGTGACCTCTCACGACGCTTCT
ACCAATGGGCTCATCAACTTCATCAAGCAGCAGCGCGAGGCCAGAGTCCAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001184722
Insert Size 1710 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001184722.1
RefSeq Size 4275 bp
RefSeq ORF 1710 bp
Locus ID 2821
UniProt ID P06744
Protein Families Druggable Genome
Protein Pathways Amino sugar and nucleotide sugar metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Pentose phosphate pathway, Starch and sucrose metabolism
MW 64.3 kDa
Gene Summary This gene encodes a member of the glucose phosphate isomerase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. In the cytoplasm, the gene product functions as a glycolytic enzyme (glucose-6-phosphate isomerase) that interconverts glucose-6-phosphate and fructose-6-phosphate. Extracellularly, the encoded protein (also referred to as neuroleukin) functions as a neurotrophic factor that promotes survival of skeletal motor neurons and sensory neurons, and as a lymphokine that induces immunoglobulin secretion. The encoded protein is also referred to as autocrine motility factor based on an additional function as a tumor-secreted cytokine and angiogenic factor. Defects in this gene are the cause of nonspherocytic hemolytic anemia and a severe enzyme deficiency can be associated with hydrops fetalis, immediate neonatal death and neurological impairment. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (1) lacks an in-frame exon in the central coding region, compared to variant 3. The encoded isoform (1) is shorter, compared to isoform 3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Glucose 6 phosphate isomerase产品

Customer Reviews 
Loading...