HCK (NM_001172133) Human Untagged Clone

CAT#: SC328832

HCK (untagged)-Human hemopoietic cell kinase (HCK) transcript variant 4



  "NM_001172133" in other vectors (4)

CNY 8,080.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-HCK Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms JTK9; p59Hck; p61Hck
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001172133, the custom clone sequence may differ by one or more nucleotides
ATGGGGTGCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACTGAA
ACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAGCCG
GGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGGGAGGCAGGCTCTGAGGACATC
ATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTCCAGAAG
GGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCCCTGGCC
ACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTGGAGACA
GAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTGGCTCCC
GGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGCTACTCT
TTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAGATCCGG
ACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTGCAGGAG
CTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTGCCCTGC
ATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGGGAATCC
CTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCCACCTAC
AACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTGGAGGCC
TTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAACTTCAT
GCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGAAGCTTG
CTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATTGACTTC
TCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCACCGAGAC
CTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGACTTTGGC
CTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTCCCCATC
AAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGACGTCTGG
TCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCAGGGATG
TCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCAGAGAAC
TGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAGGAGCGG
CCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAGAGCCAG
TACCAACAGCAGCCATGA
Restriction Sites Please inquire     
ACCN NM_001172133
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001172133.1, NP_001165604.1
RefSeq Size 2232 bp
RefSeq ORF 1518 bp
Locus ID 3055
UniProt ID P08631
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Chemokine signaling pathway, Fc gamma R-mediated phagocytosis
Gene Summary The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon. [provided by RefSeq, Feb 2010]
Transcript Variant: This variant (4) differs in its 5' UTR and uses the downstream AUG start codon, compared to variant 1, resulting in an isoform (b) that is shorter at the N-terminus, compared to isoform a. Both variants 1 and 4 encode isoform b. CCDS Note: This CCDS, which is supported by the mRNAs AK026432.1, BC108930.1 and others, represents a short human HCK isoform, known as p59HCK, as described in PMID:7791757. This isoform initiates translation from a downstream AUG start codon. Alternative translation initiation from an upstream non-AUG (CUG) start codon, which is well-conserved and present in a strong Kozak signal context, produces an isoform that is 21 aa longer at the N-terminus. The longer isoform, which is known as p61HCK, is represented by CCDS 33460.1. These isoforms exhibit distinct subcellular localization, as indicated in PMID:7791757.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...