HCK (NM_001172131) Human Untagged Clone

CAT#: SC328829

HCK (untagged)-Human hemopoietic cell kinase (HCK) transcript variant 2



  "NM_001172131" in other vectors (6)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-HCK Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms JTK9; p59Hck; p61Hck
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328829 representing NM_001172131.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGTGCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACTGAAACCAGCGCC
AGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAGCCGGGGCCTAATAGCCACAAC
AGCAACACACCAGGAATCAGGGAGGGCTCTGAGGACATCATCGTGGTTGCCCTGTATGATTACGAGGCC
ATTCACCACGAAGACCTCAGCTTCCAGAAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGG
TGGAAGGCTCGATCCCTGGCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGAC
TCTCTGGAGACAGAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTGGCT
CCCGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGCTACTCTTTGTCC
GTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAGATCCGGACCCTGGACAACGGG
GGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTGCAGGAGCTGGTGGACCACTACAAGAAGGGG
AACGACGGGCTCTGCCAGAAACTGTCGGTGCCCTGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAA
GATGCCTGGGAGATCCCTCGGGAATCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAA
GTCTGGATGGCCACCTACAACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCG
GTGGAGGCCTTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAACTTCAT
GCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGAAGCTTGCTGGACTTT
CTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATTGACTTCTCAGCCCAGATTGCAGAA
GGCATGGCCTTCATCGAGCAGAGGAACTACATCCACCGAGACCTCCGAGCTGCCAACATCTTGGTCTCT
GCATCCCTGGTGTGTAAGATTGCTGACTTTGGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCT
CGGGAAGGGGCCAAGTTCCCCATCAAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATC
AAGTCAGACGTCTGGTCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCA
GGGATGTCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCAGAGAACTGC
CCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAGGAGCGGCCGACCTTCGAA
TACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAGAGCCAGTACCAACAGCAGCCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001172131
Insert Size 1515 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001172131.1
RefSeq Size 2165 bp
RefSeq ORF 1515 bp
Locus ID 3055
UniProt ID P08631
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Chemokine signaling pathway, Fc gamma R-mediated phagocytosis
MW 57.2 kDa
Gene Summary The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon. [provided by RefSeq, Feb 2010]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. This variant encodes two isoforms due to the use of alternative translation initiation codons, as demonstrated in PMIDs 1875927 and 7791757. The longer isoform (c) is derived from an upstream non-AUG (CUG) start codon, while the shorter isoform (d) is derived from a downstream AUG start codon. The shorter isoform (d) is represented in this RefSeq, and is overall shorter, compared to isoform a. CCDS Note: This CCDS, which is supported by the mRNAs AK289896.1 and BC113854.1, represents a short human HCK isoform, as described in PMID:7791757. This isoform initiates translation from a downstream AUG start codon. Alternative translation initiation from an upstream non-AUG (CUG) start codon, which is well-conserved and present in a strong Kozak signal context, produces an isoform that is 21 aa longer at the N-terminus. The longer isoform encoded by this variant is represented by CCDS 54453.1. These isoforms exhibit distinct subcellular localization, as indicated in PMID:7791757.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...