United States
Germany
Japan
United Kingdom
China
SSH3BP1 (ABI1) (NM_001178122) Human Untagged Clone
CAT＃: SC328692
ABI1 (untagged)-Human abl-interactor 1 (ABI1) transcript variant 9
CNY 6,750.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ABI-1; ABLBP4; E3B1; NAP1BP; SSH3BP; SSH3BP1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001178122, the custom clone sequence may differ by one or more nucleotides
ATGGCAGAGCTGCAGATGTTACTAGAGGAGGAGATCCCGTCTGGCAAGAGGGCGCTGATC GAGAGTTACCAGAACCTGACTCGGGTGGCAGACTACTGTGAAAACAACTACATACAGGCT ACAGACAAGAGAAAAGCTTTAGAGGAGACCAAAGCCTATACAACCCAATCTCTAGCTAGT GTTGCTTATCAAATAAATGCATTGGCCAACAATGTACTCCAGTTGCTGGATATCCAAGCC TCTCAGCTTCGGAGAATGGAGTCTTCCATCAATCATATCTCACAGACTGTGGATATTCAT AAGGAGAAAGTGGCACGAAGAGAGATTGGTATTTTGACAACAAATAAGAATACATCAAGA ACTCACAAAATAATAGCACCTGCGAATATGGAGCGCCCTGTAAGGTATATTCGGAAACCT ATCGATTACACAGTTCTGGATGATGTGGGCCATGGTGTCAAGTGGCTAAAAGCCAAGCAT GGAAATAACCAGCCTGCAAGAACTGGCACACTGTCGAGAACAAATCCTCCTACTCAGAAA CCGCCAAGTCCTCCCATGTCAGGCCGGGGAACACTGGGACGGAATACTCCTTATAAAACC CTGGAACCTGTTAAACCCCCAACAGTTCCTAATGACTATATGACCAGTCCTGCTAGGCTT GGAAGTCAGCATAGTCCAGGCAGGACAGCATCTTTAAATCAGAGACCAAGGACACACAGT GGAAGTAGTGGAGGAAGTGGAAGTCGAGAAAACAGTGGTAGCAGTAGTATTGGCATTCCC ATTGCTGTGCCTACACCTTCGCCACCCACTATTGGACCAGTTTCTATTGCTCCACCCCCT CCCCCTATGCCTCAGTTGACTCCACAGATACCTCTCACAGGCTTCGTGGCCAGGGTGCAG GAAAACATTGCTGATAGTCCAACTCCACCGCCACCACCTCCACCAGATGACATTCCCATG TTTGATGACTCTCCACCTCCCCCACCACCACCACCAGTGGATTATGAAGATGAGGAGGCT GCAGTAGTTCAGTATAATGATCCATATGCAGATGGGGATCCTGCTTGGGCCCCCAAGAAT TATATTGAGAAAGTTGTTGCAATATATGATTATACAAAAGACAAGGATGATGAGCTGTCA TTTATGGAGGGTGCAATCATTTATGTTATAAAGAAGAATGATGATGGCTGGTATGAAGGA GTCTGCAATCGAGTGACTGGTCTGTTCCCTGGGAACTATGTTGAATCAATCATGCACTAT ACTGATTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001178122 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001178122.1, NP_001171593.1 |
| RefSeq Size | 3467 bp |
| RefSeq ORF | 1269 bp |
| Locus ID | 10006 |
| UniProt ID | Q8IZP0 |
| Gene Summary | This gene encodes a member of the Abelson-interactor family of adaptor proteins. These proteins facilitate signal transduction as components of several multiprotein complexes, and regulate actin polymerization and cytoskeletal remodeling through interactions with Abelson tyrosine kinases. The encoded protein plays a role in macropinocytosis as a component of the WAVE2 complex, and also forms a complex with EPS8 and SOS1 that mediates signal transduction from Ras to Rac. This gene may play a role in the progression of several malignancies including melanoma, colon cancer and breast cancer, and a t(10;11) chromosomal translocation involving this gene and the MLL gene has been associated with acute myeloid leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 14. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (9) lacks two alternate in-frame coding exons, compared to variant 1. The resulting protein (isoform i) has the same N- and C-termini but is shorter when it is compared to isoform a. This isoform has also been called 'variant 41'. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC230054 | ABI1 (Myc-DDK-tagged)-Human abl-interactor 1 (ABI1), transcript variant 9 |
CNY 3,656.00 |
|
| RC230054L3 | Lenti-ORF clone of ABI1 (Myc-DDK-tagged)-Human abl-interactor 1 (ABI1), transcript variant 9 |
CNY 5,890.00 |
|
| RC230054L4 | Lenti-ORF clone of ABI1 (mGFP-tagged)-Human abl-interactor 1 (ABI1), transcript variant 9 |
CNY 5,890.00 |
|
| RG230054 | ABI1 (tGFP-tagged) - Human abl-interactor 1 (ABI1), transcript variant 9 |
CNY 4,370.00 |
其它SSH3BP1产品
