SLC22A8 (NM_001184736) Human Untagged Clone
CAT#: SC328684
SLC22A8 (untagged)-Human solute carrier family 22 (organic anion transporter) member 8 (SLC22A8) transcript variant 4
CNY 7,220.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | OAT3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001184736, the custom clone sequence may differ by one or more nucleotides
ATGGCCCAGTCTATCTTCATGGCAGGTATACTGATTGGAGGGCTCGTGCTTGGAGACCTG TCTGACAGGTTTGGCCGCAGGCCCATCCTGACCTGCAGCTACCTGCTGCTGGCAGCCAGC GGCTCCGGTGCAGCCTTCAGCCCCACCTTCCCCATCTACATGGTCTTCCGCTTCCTGTGT GGCTTTGGCATCTCAGGCATTACCCTGAGCACCGTCATCTTGAATGTGGAATGGGTGCCT ACCCGGATGCGGGCCATCATGTCGACAGCACTCGGGTACTGCTACACCTTTGGCCAGTTC ATTCTGCCCGGCCTGGCCTACGCCATCCCCCAGTGGCGTTGGCTGCAGTTAACTGTGTCC ATTCCCTTCTTCGTCTTCTTCCTATCATCCTGGTGGACACCAGAGTCCATACGCTGGTTG GTCTTGTCTGGAAAGTCCTCGAAGGCCCTGAAGATACTCCGGCGGGTGGCTGTCTTCAAT GGCAAGAAGGAAGAGGGAGAAAGGCTCAGCTTGGAGGAGCTCAAACTCAACCTGCAGAAG GAGATCTCCTTGGCCAAGGCCAAGTACACCGCAAGTGACCTGTTCCGGATACCCATGCTG CGCCGCATGACCTTCTGTCTTTCCCTGGCCTGGTTTGCTACCGGTTTTGCCTACTATAGT TTGGCTATGGGTGTGGAAGAATTTGGAGTCAACCTCTACATCCTCCAGATCATCTTTGGT GGGGTCGATGTCCCAGCCAAGTTCATCACCATCCTCTCCTTAAGCTACCTGGGCCGGCAT ACCACTCAGGCCGCTGCCCTGCTCCTGGCAGGAGGGGCCATCTTGGCTCTCACCTTTGTG CCCTTGGACTTGCAGACCGTGAGGACAGTATTGGCTGTGTTTGGGAAGGGATGCCTATCC AGCTCCTTCAGCTGCCTCTTCCTCTACACAAGTGAATTATACCCCACAGTCATCAGGCAA ACAGGTATGGGCGTAAGTAACCTGTGGACCCGCGTGGGAAGCATGGTGTCCCCGCTGGTG AAAATCACGGGTGAGGTACAGCCCTTCATCCCCAATATCATCTACGGGATCACCGCCCTC CTCGGGGGCAGTGCTGCCCTCTTCCTGCCTGAGACCCTGAATCAGCCCTTGCCAGAGACT ATCGAAGACCTGGAAAACTGGTCCCTGCGGGCAAAGAAGCCAAAGCAGGAGCCAGAGGTG GAAAAGGCCTCCCAGAGGATCCCTCTACAGCCTCACGGACCAGGCCTGGGCTCCAGCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001184736 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001184736.1, NP_001171665.1 |
RefSeq Size | 1839 bp |
RefSeq ORF | 1260 bp |
Locus ID | 9376 |
UniProt ID | Q8TCC7 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a protein involved in the sodium-independent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and appears to be localized to the basolateral membrane of the kidney. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, May 2010] Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region and uses a downstream start codon, compared to variant 1. Isoform 3 has a shorter N-terminus, compared to isoform 1. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Interaction of hydroxycinnamic acids and their conjugates with organic anion transporters and ATP-binding cassette transporters.
,null,
Molecular nutrition & food research
,PubMed ID 21538853
[SLC22A8]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230046 | SLC22A8 (Myc-DDK-tagged)-Human solute carrier family 22 (organic anion transporter), member 8 (SLC22A8), transcript variant 4 |
CNY 5,420.00 |
|
RC230046L3 | Lenti-ORF clone of SLC22A8 (Myc-DDK-tagged)-Human solute carrier family 22 (organic anion transporter), member 8 (SLC22A8), transcript variant 4 |
CNY 7,320.00 |
|
RC230046L4 | Lenti-ORF clone of SLC22A8 (mGFP-tagged)-Human solute carrier family 22 (organic anion transporter), member 8 (SLC22A8), transcript variant 4 |
CNY 7,320.00 |
|
RG230046 | SLC22A8 (tGFP-tagged) - Human solute carrier family 22 (organic anion transporter), member 8 (SLC22A8), transcript variant 4 |
CNY 5,990.00 |
其它SLC22A8产品