SIGLEC6 (NM_001177548) Human Untagged Clone

CAT#: SC328619

SIGLEC6 (untagged)-Human sialic acid binding Ig-like lectin 6 (SIGLEC6) transcript variant 5



  "NM_001177548" in other vectors (4)

CNY 6,370.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SIGLEC6 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD33L; CD33L1; CD33L2; CD327; CDW327; OBBP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328619 representing NM_001177548.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGGGAGCCCAGGAAGCCTCCGCCTCAGAGATGCTACCGCTGCTGCTGCCCCTGCTGTGGGCAGGG
GCCCTGGCTCAGGAGCGGAGATTCCAGCTGGAGGGGCCAGAGTCACTGACGGTGCAGGAGGGTCTGTGC
GTCCTCGTACCCTGCAGATTGCCCACTACCCTTCCAGCCTCGTACTATGGTTATGGCTACTGGTTCCTG
GAAGGGGCTGATGTTCCAGTGGCCACAAACGACCCAGACGAAGAAGTGCAGGAGGAGACCCGGGGCCGA
TTCCACCTCCTCTGGGATCCCAGAAGGAAGAACTGCTCCCTGAGCATCAGAGATGCCCGGAGGAGGGAC
AATGCTGCATACTTCTTTCGGTTGAAGTCCAAATGGATGAAATACGGTTATACATCTTCCAAGCTCTCT
GTGCGTGTGATGGCCCTGACCCACAGGCCCAACATCTCCATCCCAGGGACCCTGGAGTCTGGCCATCCC
AGCAATCTGACCTGCTCTGTGCCCTGGGTCTGTGAGCAGGGGACGCCCCCCATCTTCTCCTGGATGTCA
GCTGCCCCCACCTCCCTGGGCCCCAGGACCACCCAGTCCTCGGTGCTCACAATCACCCCACGGCCCCAG
GACCACAGCACCAACCTCACCTGTCAGGTGACGTTCCCTGGAGCCGGTGTGACCATGGAGAGAACCATC
CAGCTCAATGTCTCCTGGATGTTGAGGCGGCCACCTCTTTCCACCCCAGATGCTCCACAGAAAGTGGCC
ATCAGCATCTTCCAAGGAAACAGCGCAGCCTTCAAAATCCTGCAAAACACCTCGTCCCTCCCTGTCCTG
GAGGGCCAGGCTCTGCGGCTGCTCTGTGATGCTGACGGCAACCCCCCTGCACACCTGAGCTGGTTCCAG
GGCTTCCCCGCCCTGAACGCCACCCCCATCTCCAATACCGGGGTCCTGGAGCTGCCTCAAGTAGGGTCT
GCAGAAGAAGGAGATTTCACCTGCCGTGCTCAGCATCCTCTGGGCTCCCTGCAAATCTCTCTGAGTCTC
TTTGTGCATTGGAAACCAGAAGGCAGGGCTGGTGGTGTCCTGGGAGCAGTCTGGGGAGCTAGCATCACA
ACCCTGGTTTTCCTCTGTGTTTGCTTCATCTTCAGGGTCATCAGCACCAGTTCCAGACAGGCATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001177548
Insert Size 1170 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001177548.2
RefSeq Size 3814 bp
RefSeq ORF 1170 bp
Locus ID 946
UniProt ID O43699
Protein Families Druggable Genome, Secreted Protein, Transmembrane
MW 42.6 kDa
Gene Summary This gene encodes a member of the SIGLEC (sialic acid binding immunoglobulin-like lectin) family of proteins. The encoded transmembrane receptor binds sialyl-TN glycans and leptin. Placental expression of the encoded protein is upregulated in preeclampsia. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (5) uses an alternate, in-frame splice site and lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (5) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...