Carbohydrate sulfotransferase 4 (CHST4) (NM_001166395) Human Untagged Clone
CAT#: SC328611
CHST4 (untagged)-Human carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 (CHST4) transcript variant 2
CNY 7,220.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GlcNAc6ST2; GST3; HECGLCNAC6ST; LSST |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001166395, the custom clone sequence may differ by one or more nucleotides
ATGCTACTGCCTAAAAAAATGAAGCTCCTGCTGTTTCTGGTTTCCCAGATGGCCATCTTG GCTCTATTCTTCCACATGTACAGCCACAACATCAGCTCCCTGTCTATGAAGGCACAGCCC GAGCGCATGCACGTGCTGGTTCTGTCTTCCTGGCGCTCTGGCTCTTCTTTTGTGGGGCAG CTTTTTGGGCAGCACCCAGATGTTTTCTACCTGATGGAGCCCGCCTGGCACGTGTGGATG ACCTTCAAGCAGAGCACCGCCTGGATGCTGCACATGGCTGTGCGGGATCTGATACGGGCC GTCTTCTTGTGCGACATGAGCGTCTTTGATGCCTACATGGAACCTGGTCCCCGGAGACAG TCCAGCCTCTTTCAGTGGGAGAACAGCCGGGCCCTGTGTTCTGCACCTGCCTGTGACATC ATCCCACAAGATGAAATCATCCCCCGGGCTCACTGCAGGCTCCTGTGCAGTCAACAGCCC TTTGAGGTGGTGGAGAAGGCCTGCCGCTCCTACAGCCACGTGGTGCTCAAGGAGGTGCGC TTCTTCAACCTGCAGTCCCTCTACCCGCTGCTGAAAGACCCCTCCCTCAACCTGCATATC GTGCACCTGGTCCGGGACCCCCGGGCCGTGTTCCGTTCCCGAGAACGCACAAAGGGAGAT CTCATGATTGACAGTCGCATTGTGATGGGGCAGCATGAGCAAAAACTCAAGAAGGAGGAC CAACCCTACTATGTGATGCAGGTCATCTGCCAAAGCCAGCTGGAGATCTACAAGACCATC CAGTCCTTGCCCAAGGCCCTGCAGGAACGCTACCTGCTTGTGCGCTATGAGGACCTGGCT CGAGCCCCTGTGGCCCAGACTTCCCGAATGTATGAATTCGTGGGATTGGAATTCTTGCCC CATCTTCAGACCTGGGTGCATAACATCACCCGAGGCAAGGGCATGGGTGACCACGCTTTC CACACAAATGCCAGGGATGCCCTTAATGTCTCCCAGGCTTGGCGCTGGTCTTTGCCCTAT GAAAAGGTTTCTCGACTTCAGAAAGCCTGTGGCGATGCCATGAATTTGCTGGGCTACCGC CACGTCAGATCTGAACAAGAACAGAGAAACCTGTTGCTGGATCTTCTGTCTACCTGGACT GTCCCTGAGCAAATCCACTAA |
Restriction Sites | Please inquire |
ACCN | NM_001166395 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001166395.1, NP_001159867.1 |
RefSeq Size | 2197 bp |
RefSeq ORF | 1161 bp |
Locus ID | 10164 |
UniProt ID | Q8NCG5 |
Protein Families | Transmembrane |
Protein Pathways | Keratan sulfate biosynthesis, Metabolic pathways |
Gene Summary | This gene encodes an N-acetylglucosamine 6-O sulfotransferase. The encoded enzyme transfers sulfate from 3'phosphoadenosine 5'phospho-sulfate to the 6-hydroxyl group of N-acetylglucosamine on glycoproteins. This protein is localized to the Golgi and is involved in the modification of glycan structures on ligands of the lymphocyte homing receptor L-selectin. Alternate splicing in the 5' UTR results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (2) has an alternate 5' UTR exon, as compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229973 | CHST4 (Myc-DDK-tagged)-Human carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 (CHST4), transcript variant 2 |
CNY 3,990.00 |
|
RC229973L3 | Lenti-ORF clone of CHST4 (Myc-DDK-tagged)-Human carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 (CHST4), transcript variant 2 |
CNY 5,890.00 |
|
RC229973L4 | Lenti-ORF clone of CHST4 (mGFP-tagged)-Human carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 (CHST4), transcript variant 2 |
CNY 5,890.00 |
|
RG229973 | CHST4 (tGFP-tagged) - Human carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 (CHST4), transcript variant 2 |
CNY 5,624.00 |
其它Carbohydrate sulfotransferase 4产品