BCAT1 (NM_001178094) Human Untagged Clone
CAT#: SC328610
BCAT1 (untagged)-Human branched chain amino-acid transaminase 1 cytosolic (BCAT1) transcript variant 5
CN¥ 6,270.00
Product images

CN¥ 1,999.00
CN¥ 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BCATC; BCT1; ECA39; MECA39; PNAS121; PP18 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328610 representing NM_001178094.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGATTGCAGTAACGGATGCTCCGCAGAGTGTACCGGAGAAGGAGGATCAAAAGAGGTGGTGGGGACT TTTAAGGCTAAAGACCTAATAGTCACACCAGCTACCATTTTAAAGGAAAAACCAGACCCCAATAATCTG GTTTTTGGAACTGTGTTCACGGATCATATGCTGACGGTGGAGTGGTCCTCAGAGTTTGGATGGGAGAAA CCTCATATCAAGCCTCTTCAGAACCTGTCATTGCACCCTGGCTCATCAGCTTTGCACTATGCAGTGGAA TTATTTGAAGGATTGAAGGCATTTCGAGGAGTAGATAATAAAATTCGACTGTTTCAGCCAAACCTCAAC ATGGATAGAATGTATCGCTCTGCTGTGAGGGCAACTCTGCCGGTATTTGACAAAGAAGAGCTCTTAGAG TGTATTCAACAGCTTGTGAAATTGGATCAAGAATGGGTCCCATATTCAACATCTGCTAGTCTGTATATT CGTCCTACATTCATTGGAACTGAGCCTTCTCTTGGAGTCAAGAAGCCTACCAAAGCCCTGCTCTTTGTA CTCTTGAGCCCAGTGGGACCTTATTTTTCAAGTGGAACCTTTAATCCAGTGTCCCTGTGGGCCAATCCC AAGTATGTAAGAGCCTGGAAAGGTGGAACTGGGGACTGCAAGATGGGAGGGAATTACGGCTCATCTCTT TTTGCCCAATGTGAAGCAGTAGATAATGGGTGTCAGCAGGTCCTGTGGCTCTATGGAGAGGACCATCAG ATCACTGAAGTGGGAACTATGAATCTTTTTCTTTACTGGATAAATGAAGATGGAGAAGAAGAACTGGCA ACTCCTCCACTAGATGGCATCATTCTTCCAGGAGTGACAAGGCGGTGCATTCTGGACCTGGCACATCAG TGGGGTGAATTTAAGGTGTCAGAGAGATACCTCACCATGGATGACTTGACAACAGCCCTGGAGGGGAAC AGAGTGAGAGAGATGTTTGGCTCTGGTACAGCCTGTGTTGTTTGCCCAGTTTCTGATATACTGTACAAA GGCGAGACAATACACATTCCAACTATGGAGAATGGTCCTAAGCTGGCAAGCCGCATCTTGAGCAAATTA ACTGATATCCAGTATGGAAGAGAAGAGAGCGACTGGACAATTGTGCTATCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001178094 |
Insert Size | 1158 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001178094.1 |
RefSeq Size | 9575 bp |
RefSeq ORF | 1158 bp |
Locus ID | 586 |
UniProt ID | P54687 |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Pantothenate and CoA biosynthesis, Valine, leucine and isoleucine biosynthesis, Valine, leucine and isoleucine degradation |
MW | 42.8 kDa |
Gene Summary | This gene encodes the cytosolic form of the enzyme branched-chain amino acid transaminase. This enzyme catalyzes the reversible transamination of branched-chain alpha-keto acids to branched-chain L-amino acids essential for cell growth. Two different clinical disorders have been attributed to a defect of branched-chain amino acid transamination: hypervalinemia and hyperleucine-isoleucinemia. As there is also a gene encoding a mitochondrial form of this enzyme, mutations in either gene may contribute to these disorders. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010] Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (5) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229972 | BCAT1 (Myc-DDK-tagged)-Human branched chain amino-acid transaminase 1, cytosolic (BCAT1), transcript variant 5 |
CN¥ 3,656.00 |
|
RC229972L1 | Lenti-ORF clone of BCAT1 (Myc-DDK-tagged)-Human branched chain amino-acid transaminase 1, cytosolic (BCAT1), transcript variant 5 |
CN¥ 6,056.00 |
|
RC229972L2 | Lenti-ORF clone of BCAT1 (mGFP-tagged)-Human branched chain amino-acid transaminase 1, cytosolic (BCAT1), transcript variant 5 |
CN¥ 5,890.00 |
|
RC229972L3 | Lenti-ORF clone of BCAT1 (Myc-DDK-tagged)-Human branched chain amino-acid transaminase 1, cytosolic (BCAT1), transcript variant 5 |
CN¥ 5,890.00 |
|
RC229972L4 | Lenti-ORF clone of BCAT1 (mGFP-tagged)-Human branched chain amino-acid transaminase 1, cytosolic (BCAT1), transcript variant 5 |
CN¥ 5,890.00 |
|
RG229972 | BCAT1 (tGFP-tagged) - Human branched chain amino-acid transaminase 1, cytosolic (BCAT1), transcript variant 5 |
CN¥ 4,370.00 |