FUZ (NM_001171937) Human Untagged Clone
CAT#: SC328605
FUZ (untagged)-Human fuzzy homolog (Drosophila) (FUZ) transcript variant 2
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CPLANE3; FY; NTD |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001171937, the custom clone sequence may differ by one or more nucleotides
ATGGGGGAGGAGGGGACGGGCGGCACTGTGCATCTGCTGTGCCTCGCGGCCTCCAGCGGG GTCCCCCTATTCTGCAGGAGCAGTCGCGGCGGCGCCCCCGCCCGTCAGCAGCTCCCGTTC TCTGTCATCGGTTCCCTCAATGGAGTCCACATGTTTGGGCAGAATCTGGAGGTGCAGCTG AGCTCTGCGAGGACCGAGAACACGACTGTGGTCCTTCTTGTGGGACTTGAAGAACTGACC AATATCCGCAACGTGGAGAGACTGAAGAAGGACTTGAGGGCCAGTTATTGCCTCATCGAC AGCTTCCTGGGGGACTCGGAGCTCATCGGGGACCTGACCCAGTGTGTGGACTGCGTGATT CCTCCAGAGGGGTCCCTCTTGCAGGAAGCCCTCTCCGGGTTCGCTGAGGCCGCGGGCACG ACCTTCGTCAGTCTGGTGGTGTCCGGCCGGGTGGTGGCAGCAACAGAGGGTTGGTGGCGG CTGGGGACGCCCGAGGCCGTGCTGCTCCCCTGGCTGGTGGGGTCCCTGCCGCCGCAGACC GCTCGCGACTACCCGGTGTACCTGCCGCACGGGAGCCCCACGGTCCCACACCGGCTCCTG ACCCTGACTCTGCTGCCGAGCCTGGAGCTGTGTCTACTCTGCGGGCCGAGCCCACCCCTC AGCCAGTTGTATCCACAGCTTCTGGAGCGCTGGTGGCAGCCACTGCTGGACCCGTTGCGG GCCTGTCTGCCGTTGGGACCCCGGGCGCTGCCCAGTGGCTTCCCCCTTCACACAGACATC CTCGGGCTGCTGCTCCTCCACCTGGAACTGAAGCGCTGCCTCTTCACCGTGGAGCCCTTG GGGGATAAAGAGCCTTCACCAGAACAGCGCCGGCGCCTCCTCCGAAACTTCTATACCCTG GTCACCTCCACGCACTTCCCACCAGAGCCAGGGCCACCAGAGAAGACAGAAGATGAGGTC TACCAGGCCCAGCTGCCCAGAGCTTGCTACCTGGTGTTGGGGACTGAGGAACCAGGCACA GGAGTGCGTCTGGTGGCCTTGCAGCTGGGGCTTCGGCGGCTGCTGCTGCTGCTGTCTCCC CAGAGTCCCACCCATGGGCTGCGAAGCCTGGCCACCCACACTCTGCATGCCCTCACCCCA CTTCTTTGA |
Restriction Sites | Please inquire |
ACCN | NM_001171937 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001171937.1, NP_001165408.1 |
RefSeq Size | 1654 bp |
RefSeq ORF | 1149 bp |
Locus ID | 80199 |
UniProt ID | Q9BT04 |
Gene Summary | This gene encodes a planar cell polarity protein that is involved in ciliogenesis and directional cell movement. Knockout studies in mice exhibit neural tube defects and defective cilia, and mutations in this gene are associated with neural tube defects in humans. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (2) uses an alternate donor splice site and lacks an in-frame exon in the 5' coding region compared to variant 1, which results in a shorter isoform (2) missing an internal protein segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229967 | FUZ (Myc-DDK-tagged)-Human fuzzy homolog (Drosophila) (FUZ), transcript variant 2 |
CNY 3,990.00 |
|
RC229967L3 | Lenti-ORF clone of FUZ (Myc-DDK-tagged)-Human fuzzy homolog (Drosophila) (FUZ), transcript variant 2 |
CNY 5,890.00 |
|
RC229967L4 | Lenti-ORF clone of FUZ (mGFP-tagged)-Human fuzzy homolog (Drosophila) (FUZ), transcript variant 2 |
CNY 5,890.00 |
|
RG229967 | FUZ (tGFP-tagged) - Human fuzzy homolog (Drosophila) (FUZ), transcript variant 2 |
CNY 4,370.00 |